\
| Variant ID: vg0405058837 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 5058837 |
| Reference Allele: T | Alternative Allele: A |
| Primary Allele: A | Secondary Allele: T |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.75, A: 0.25, others allele: 0.00, population size: 177. )
TTTGAAATAAGTGGTTTCCCGTTGTCCAAGAGCAGATACCAACGCATGCATGACAAGAAGTGCCTATGTCGCTTAAAATTATTTTTTGATCTGTTTATTG[T/A]
TATTATTTTCAACAAGTCATTGCAAAAACTTAAATAACACAGATTAACATCTTTCTGAGTTTAAAATTTTGAGACTCCTTATTTATTTTAAAAGTTTTGA
TCAAAACTTTTAAAATAAATAAGGAGTCTCAAAATTTTAAACTCAGAAAGATGTTAATCTGTGTTATTTAAGTTTTTGCAATGACTTGTTGAAAATAATA[A/T]
CAATAAACAGATCAAAAAATAATTTTAAGCGACATAGGCACTTCTTGTCATGCATGCGTTGGTATCTGCTCTTGGACAACGGGAAACCACTTATTTCAAA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 64.30% | 33.40% | 0.06% | 2.24% | NA |
| All Indica | 2759 | 91.90% | 6.30% | 0.11% | 1.67% | NA |
| All Japonica | 1512 | 6.90% | 89.40% | 0.00% | 3.77% | NA |
| Aus | 269 | 94.80% | 4.80% | 0.00% | 0.37% | NA |
| Indica I | 595 | 96.10% | 3.20% | 0.17% | 0.50% | NA |
| Indica II | 465 | 84.50% | 9.90% | 0.00% | 5.59% | NA |
| Indica III | 913 | 94.50% | 5.40% | 0.00% | 0.11% | NA |
| Indica Intermediate | 786 | 89.90% | 7.80% | 0.25% | 2.04% | NA |
| Temperate Japonica | 767 | 1.20% | 98.70% | 0.00% | 0.13% | NA |
| Tropical Japonica | 504 | 15.70% | 73.20% | 0.00% | 11.11% | NA |
| Japonica Intermediate | 241 | 6.60% | 93.40% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 91.70% | 8.30% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 63.30% | 34.40% | 0.00% | 2.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0405058837 | T -> DEL | N | N | silent_mutation | Average:33.39; most accessible tissue: Zhenshan97 flower, score: 77.366 | N | N | N | N |
| vg0405058837 | T -> A | LOC_Os04g09450.1 | downstream_gene_variant ; 862.0bp to feature; MODIFIER | silent_mutation | Average:33.39; most accessible tissue: Zhenshan97 flower, score: 77.366 | N | N | N | N |
| vg0405058837 | T -> A | LOC_Os04g09430-LOC_Os04g09450 | intergenic_region ; MODIFIER | silent_mutation | Average:33.39; most accessible tissue: Zhenshan97 flower, score: 77.366 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0405058837 | 5.95E-07 | 6.71E-18 | mr1035 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405058837 | 2.04E-06 | 2.18E-07 | mr1035 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405058837 | NA | 8.98E-14 | mr1626 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405058837 | NA | 1.04E-28 | mr1631 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405058837 | 1.73E-06 | 7.12E-17 | mr1035_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405058837 | 8.91E-08 | NA | mr1178_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405058837 | NA | 3.72E-63 | mr1402_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405058837 | NA | 1.02E-23 | mr1403_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405058837 | NA | 6.89E-06 | mr1613_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405058837 | NA | 5.07E-33 | mr1631_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405058837 | NA | 3.44E-08 | mr1837_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405058837 | NA | 1.24E-18 | mr1945_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405058837 | NA | 2.27E-06 | mr1962_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |