\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0405052013:

Variant ID: vg0405052013 (JBrowse)Variation Type: INDEL
Chromosome: chr04Position: 5052013
Reference Allele: AAlternative Allele: G,ACACTGGT,ACACTGGTGGAGAAGTGCTTTTTAGTCCC
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.67, G: 0.33, others allele: 0.00, population size: 88. )

Flanking Sequence (100 bp) in Reference Genome:


GATAGATCGCTTTAAAGGTGTGATGTGCGATTTGATTATATGACCGACGTTATGATTGTCCTAACTATTTGATCAAAGGGCATATTTTCCTAGTTAACAT[A/G,ACACTGGT,ACACTGGTGGAGAAGTGCTTTTTAGTCCC]
GGAGCTCGTAGAAAGTGTCCAATTAGTATTTGTATAGATATAAAAGGTATATATTTGGAGGTTTCTCTTTACTCGACATTTAAATGTTAAATCACCTATC

Reverse complement sequence

GATAGGTGATTTAACATTTAAATGTCGAGTAAAGAGAAACCTCCAAATATATACCTTTTATATCTATACAAATACTAATTGGACACTTTCTACGAGCTCC[T/C,ACCAGTGT,GGGACTAAAAAGCACTTCTCCACCAGTGT]
ATGTTAACTAGGAAAATATGCCCTTTGATCAAATAGTTAGGACAATCATAACGTCGGTCATATAATCAAATCGCACATCACACCTTTAAAGCGATCTATC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 66.10% 30.80% 0.57% 2.45% ACACTGGT: 0.04%; ACACTGGTGGAGAAGTGCTTTTTAGTCCC: 0.02%
All Indica  2759 94.30% 3.60% 0.14% 1.88% NA
All Japonica  1512 7.80% 86.80% 1.19% 3.97% ACACTGGT: 0.13%; ACACTGGTGGAGAAGTGCTTTTTAGTCCC: 0.07%
Aus  269 96.30% 1.90% 1.49% 0.37% NA
Indica I  595 96.10% 3.00% 0.17% 0.67% NA
Indica II  465 89.70% 4.30% 0.00% 6.02% NA
Indica III  913 97.40% 2.30% 0.11% 0.22% NA
Indica Intermediate  786 92.20% 5.20% 0.25% 2.29% NA
Temperate Japonica  767 1.20% 96.00% 2.35% 0.13% ACACTGGT: 0.26%; ACACTGGTGGAGAAGTGCTTTTTAGTCCC: 0.13%
Tropical Japonica  504 18.50% 70.20% 0.00% 11.31% NA
Japonica Intermediate  241 6.60% 92.50% 0.00% 0.83% NA
VI/Aromatic  96 91.70% 8.30% 0.00% 0.00% NA
Intermediate  90 64.40% 31.10% 1.11% 3.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0405052013 A -> DEL N N silent_mutation Average:24.394; most accessible tissue: Zhenshan97 flag leaf, score: 58.772 N N N N
vg0405052013 A -> ACACTGGT LOC_Os04g09430-LOC_Os04g09450 intergenic_region ; MODIFIER silent_mutation Average:24.394; most accessible tissue: Zhenshan97 flag leaf, score: 58.772 N N N N
vg0405052013 A -> G LOC_Os04g09430-LOC_Os04g09450 intergenic_region ; MODIFIER silent_mutation Average:24.394; most accessible tissue: Zhenshan97 flag leaf, score: 58.772 N N N N
vg0405052013 A -> ACACTGGTGGAGAAGTGCTTTTTAGTCCC LOC_Os04g09430-LOC_Os04g09450 intergenic_region ; MODIFIER silent_mutation Average:24.394; most accessible tissue: Zhenshan97 flag leaf, score: 58.772 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0405052013 NA 1.85E-17 mr1035 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405052013 NA 5.36E-14 mr1062 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405052013 NA 1.72E-89 mr1071 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405052013 NA 7.45E-80 mr1080 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405052013 NA 1.34E-77 mr1100 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405052013 NA 3.92E-50 mr1136 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405052013 NA 4.85E-91 mr1140 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405052013 NA 1.25E-95 mr1203 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405052013 NA 2.73E-88 mr1395 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405052013 NA 3.63E-79 mr1613 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405052013 NA 2.65E-94 mr1618 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405052013 NA 1.16E-13 mr1626 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405052013 NA 4.65E-30 mr1631 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405052013 NA 1.00E-09 mr1637 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405052013 NA 6.36E-24 mr1888 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405052013 2.18E-06 4.30E-17 mr1035_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405052013 3.06E-08 2.56E-113 mr1071_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405052013 NA 3.45E-06 mr1071_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405052013 2.80E-08 9.26E-112 mr1080_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405052013 NA 1.30E-06 mr1080_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405052013 5.67E-06 6.94E-104 mr1100_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405052013 NA 2.06E-06 mr1100_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405052013 1.07E-06 3.60E-62 mr1136_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405052013 1.61E-08 6.77E-120 mr1203_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405052013 NA 3.39E-06 mr1203_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405052013 NA 4.30E-28 mr1238_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405052013 NA 1.10E-40 mr1243_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405052013 NA 1.80E-36 mr1251_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405052013 NA 9.15E-20 mr1276_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405052013 NA 3.05E-12 mr1377_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405052013 5.87E-07 5.36E-73 mr1402_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405052013 5.53E-06 4.94E-08 mr1402_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405052013 NA 1.27E-29 mr1423_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405052013 NA 1.15E-36 mr1435_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405052013 NA 9.01E-26 mr1484_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405052013 NA 1.65E-58 mr1599_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405052013 6.41E-09 4.68E-129 mr1613_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405052013 4.78E-06 3.65E-09 mr1613_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405052013 NA 3.53E-26 mr1617_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405052013 1.80E-08 1.47E-106 mr1619_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405052013 7.60E-06 7.39E-07 mr1619_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405052013 NA 1.79E-34 mr1631_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405052013 NA 1.93E-19 mr1637_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405052013 2.67E-06 7.08E-08 mr1795_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405052013 NA 2.76E-08 mr1837_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405052013 NA 1.43E-35 mr1888_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405052013 NA 5.63E-20 mr1945_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405052013 5.59E-07 1.83E-120 mr1962_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405052013 1.05E-07 1.35E-11 mr1962_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251