Search for Variation information by Variation ID:
Detailed information for vg0404978718:
| Variant ID: vg0404978718 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 4978718 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
Flanking Sequence (100 bp) in Reference Genome:
TTAATAATTTCCAAAATCGGATTGATTACGCCGTGCAACATGCTTTGATCAATCAATCTGGAGTATTAGTCAATACCTTATCAAACATGGTGAAGTCAAT[A/G]
GTTGATGGTTCAATAGCTGAGTATCAGGCCACAGGACCAGTCTATTTACCAGGGGTTATTTTCCCAAACTATCGGCCCTTGGTCCCAAACAGTCAGCCGA
Reverse complement sequence
TCGGCTGACTGTTTGGGACCAAGGGCCGATAGTTTGGGAAAATAACCCCTGGTAAATAGACTGGTCCTGTGGCCTGATACTCAGCTATTGAACCATCAAC[T/C]
ATTGACTTCACCATGTTTGATAAGGTATTGACTAATACTCCAGATTGATTGATCAAAGCATGTTGCACGGCGTAATCAATCCGATTTTGGAAATTATTAA
Allele Frequencies:
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 26.70% | 6.40% | 4.99% | 61.96% | NA |
| All Indica | 2759 | 14.30% | 1.00% | 6.16% | 78.54% | NA |
| All Japonica | 1512 | 53.30% | 12.60% | 1.39% | 32.67% | NA |
| Aus | 269 | 8.20% | 0.70% | 11.15% | 79.93% | NA |
| Indica I | 595 | 19.70% | 1.20% | 7.06% | 72.10% | NA |
| Indica II | 465 | 23.00% | 0.00% | 6.67% | 70.32% | NA |
| Indica III | 913 | 4.30% | 1.20% | 4.49% | 90.03% | NA |
| Indica Intermediate | 786 | 16.70% | 1.30% | 7.12% | 74.94% | NA |
| Temperate Japonica | 767 | 57.80% | 6.00% | 1.43% | 34.81% | NA |
| Tropical Japonica | 504 | 52.00% | 13.30% | 0.99% | 33.73% | NA |
| Japonica Intermediate | 241 | 41.90% | 32.40% | 2.07% | 23.65% | NA |
| VI/Aromatic | 96 | 10.40% | 68.80% | 7.29% | 13.54% | NA |
| Intermediate | 90 | 31.10% | 16.70% | 8.89% | 43.33% | NA |
Allele Effect:
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0404978718 | A -> DEL | LOC_Os04g09360.1 | N | frameshift_variant | Average:15.738; most accessible tissue: Callus, score: 56.061 | N | N | N | N |
| vg0404978718 | A -> G | LOC_Os04g09360.1 | missense_variant ; p.Ile185Met; MODERATE | nonsynonymous_codon ; I185M | Average:15.738; most accessible tissue: Callus, score: 56.061 | benign  |
-0.792 |
TOLERATED | 0.63 |
Putative Genotype-Phenotype Associations:
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0404978718 | NA | 1.40E-06 | mr1510 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0404978718 | 2.24E-06 | 2.24E-06 | mr1970 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0404978718 | 2.10E-07 | 2.10E-07 | mr1973 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |