Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0404871048:

Variant ID: vg0404871048 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 4871048
Reference Allele: T	Alternative Allele: A
Primary Allele: T	Secondary Allele: A

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.99, others allele: 0.00, population size: 173. )

Flanking Sequence (100 bp) in Reference Genome:

AACTAGGACTATAGATATGTCCTCGGAAGAAAAATAGTACGCTTGAAGTGCTTACATTTTGGTCCAAATTTCTAATACTAGAAATGCTTATATTTTACAA[T/A]
TAATTAGTGAGGTCTTGGTTTCGTTATAGGAAACAATATACTATGGTGTGGTTCCGTTCATTTTGATGTTAAAATTAACCGTTGGTTACTATGACTCAAT

Reverse complement sequence

ATTGAGTCATAGTAACCAACGGTTAATTTTAACATCAAAATGAACGGAACCACACCATAGTATATTGTTTCCTATAACGAAACCAAGACCTCACTAATTA[A/T]
TTGTAAAATATAAGCATTTCTAGTATTAGAAATTTGGACCAAAATGTAAGCACTTCAAGCGTACTATTTTTCTTCCGAGGACATATCTATAGTCCTAGTT

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	80.60%	0.80%	2.12%	16.44%	NA
All Indica	2759	80.90%	0.40%	1.34%	17.40%	NA
All Japonica	1512	76.50%	1.80%	4.10%	17.59%	NA
Aus	269	91.80%	0.40%	0.00%	7.81%	NA
Indica I	595	99.50%	0.30%	0.00%	0.17%	NA
Indica II	465	74.20%	1.10%	2.37%	22.37%	NA
Indica III	913	73.40%	0.10%	1.42%	25.08%	NA
Indica Intermediate	786	79.40%	0.40%	1.65%	18.58%	NA
Temperate Japonica	767	88.50%	1.00%	3.00%	7.43%	NA
Tropical Japonica	504	64.50%	1.40%	4.76%	29.37%	NA
Japonica Intermediate	241	63.50%	5.00%	6.22%	25.31%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	86.70%	1.10%	1.11%	11.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0404871048	T -> DEL	N	N	silent_mutation	Average:56.669; most accessible tissue: Minghui63 flag leaf, score: 76.453	N	N	N	N
vg0404871048	T -> A	LOC_Os04g08828.1	upstream_gene_variant ; 3326.0bp to feature; MODIFIER	silent_mutation	Average:56.669; most accessible tissue: Minghui63 flag leaf, score: 76.453	N	N	N	N
vg0404871048	T -> A	LOC_Os04g08824.1	intron_variant ; MODIFIER	silent_mutation	Average:56.669; most accessible tissue: Minghui63 flag leaf, score: 76.453	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0404871048	NA	2.51E-06	mr1180	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404871048	NA	1.48E-06	mr1280	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404871048	NA	2.17E-08	mr1280	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404871048	NA	7.48E-06	mr1294	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404871048	NA	8.32E-07	mr1510	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404871048	NA	7.67E-06	mr1729	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404871048	NA	7.77E-07	mr1729	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404871048	NA	1.26E-06	mr1788	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251