\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0404657697:

Variant ID: vg0404657697 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 4657697
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.96, T: 0.05, others allele: 0.00, population size: 94. )

Flanking Sequence (100 bp) in Reference Genome:


AAGGAAAAGTACCCCTCGTTGTTTTCTATAGTTAGAAGGAAAAATGCCTCAATTGCTAATGTTATGGGTTCTGTTCCGCTTAATGTTTCTTTTAGAGGAG[T/C]
TTTAGTTGGTCAAAATCTAATTAGATGGCATAATTTATGTGCTTCCATTGTGCATATTAACTTAACAGACGAGGATGAAATTTTTAGATGGAATTTTCAT

Reverse complement sequence

ATGAAAATTCCATCTAAAAATTTCATCCTCGTCTGTTAAGTTAATATGCACAATGGAAGCACATAAATTATGCCATCTAATTAGATTTTGACCAACTAAA[A/G]
CTCCTCTAAAAGAAACATTAAGCGGAACAGAACCCATAACATTAGCAATTGAGGCATTTTTCCTTCTAACTATAGAAAACAACGAGGGGTACTTTTCCTT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 70.40% 24.30% 2.41% 2.96% NA
All Indica  2759 85.00% 6.60% 3.52% 4.89% NA
All Japonica  1512 40.60% 58.70% 0.66% 0.07% NA
Aus  269 97.40% 1.50% 1.12% 0.00% NA
Indica I  595 97.00% 2.40% 0.34% 0.34% NA
Indica II  465 85.20% 13.30% 1.08% 0.43% NA
Indica III  913 81.20% 3.50% 6.90% 8.43% NA
Indica Intermediate  786 80.20% 9.50% 3.44% 6.87% NA
Temperate Japonica  767 12.10% 87.90% 0.00% 0.00% NA
Tropical Japonica  504 77.00% 21.20% 1.59% 0.20% NA
Japonica Intermediate  241 55.20% 44.00% 0.83% 0.00% NA
VI/Aromatic  96 46.90% 53.10% 0.00% 0.00% NA
Intermediate  90 66.70% 24.40% 4.44% 4.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0404657697 T -> C LOC_Os04g08570.1 upstream_gene_variant ; 4967.0bp to feature; MODIFIER silent_mutation Average:15.849; most accessible tissue: Minghui63 panicle, score: 29.741 N N N N
vg0404657697 T -> C LOC_Os04g08570-LOC_Os04g08580 intergenic_region ; MODIFIER silent_mutation Average:15.849; most accessible tissue: Minghui63 panicle, score: 29.741 N N N N
vg0404657697 T -> DEL N N silent_mutation Average:15.849; most accessible tissue: Minghui63 panicle, score: 29.741 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0404657697 7.98E-06 NA mr1017 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404657697 4.16E-06 NA mr1022 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404657697 NA 1.38E-09 mr1023 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404657697 4.75E-07 NA mr1055 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404657697 NA 1.14E-09 mr1132 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404657697 NA 1.18E-10 mr1142 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404657697 3.87E-06 2.64E-11 mr1390 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404657697 NA 3.90E-10 mr1023_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404657697 5.82E-06 3.78E-14 mr1178_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404657697 NA 1.22E-07 mr1399_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404657697 NA 7.93E-09 mr1746_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251