\
| Variant ID: vg0404657697 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 4657697 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.96, T: 0.05, others allele: 0.00, population size: 94. )
AAGGAAAAGTACCCCTCGTTGTTTTCTATAGTTAGAAGGAAAAATGCCTCAATTGCTAATGTTATGGGTTCTGTTCCGCTTAATGTTTCTTTTAGAGGAG[T/C]
TTTAGTTGGTCAAAATCTAATTAGATGGCATAATTTATGTGCTTCCATTGTGCATATTAACTTAACAGACGAGGATGAAATTTTTAGATGGAATTTTCAT
ATGAAAATTCCATCTAAAAATTTCATCCTCGTCTGTTAAGTTAATATGCACAATGGAAGCACATAAATTATGCCATCTAATTAGATTTTGACCAACTAAA[A/G]
CTCCTCTAAAAGAAACATTAAGCGGAACAGAACCCATAACATTAGCAATTGAGGCATTTTTCCTTCTAACTATAGAAAACAACGAGGGGTACTTTTCCTT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 70.40% | 24.30% | 2.41% | 2.96% | NA |
| All Indica | 2759 | 85.00% | 6.60% | 3.52% | 4.89% | NA |
| All Japonica | 1512 | 40.60% | 58.70% | 0.66% | 0.07% | NA |
| Aus | 269 | 97.40% | 1.50% | 1.12% | 0.00% | NA |
| Indica I | 595 | 97.00% | 2.40% | 0.34% | 0.34% | NA |
| Indica II | 465 | 85.20% | 13.30% | 1.08% | 0.43% | NA |
| Indica III | 913 | 81.20% | 3.50% | 6.90% | 8.43% | NA |
| Indica Intermediate | 786 | 80.20% | 9.50% | 3.44% | 6.87% | NA |
| Temperate Japonica | 767 | 12.10% | 87.90% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 77.00% | 21.20% | 1.59% | 0.20% | NA |
| Japonica Intermediate | 241 | 55.20% | 44.00% | 0.83% | 0.00% | NA |
| VI/Aromatic | 96 | 46.90% | 53.10% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 66.70% | 24.40% | 4.44% | 4.44% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0404657697 | T -> C | LOC_Os04g08570.1 | upstream_gene_variant ; 4967.0bp to feature; MODIFIER | silent_mutation | Average:15.849; most accessible tissue: Minghui63 panicle, score: 29.741 | N | N | N | N |
| vg0404657697 | T -> C | LOC_Os04g08570-LOC_Os04g08580 | intergenic_region ; MODIFIER | silent_mutation | Average:15.849; most accessible tissue: Minghui63 panicle, score: 29.741 | N | N | N | N |
| vg0404657697 | T -> DEL | N | N | silent_mutation | Average:15.849; most accessible tissue: Minghui63 panicle, score: 29.741 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0404657697 | 7.98E-06 | NA | mr1017 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0404657697 | 4.16E-06 | NA | mr1022 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0404657697 | NA | 1.38E-09 | mr1023 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0404657697 | 4.75E-07 | NA | mr1055 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0404657697 | NA | 1.14E-09 | mr1132 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0404657697 | NA | 1.18E-10 | mr1142 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0404657697 | 3.87E-06 | 2.64E-11 | mr1390 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0404657697 | NA | 3.90E-10 | mr1023_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0404657697 | 5.82E-06 | 3.78E-14 | mr1178_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0404657697 | NA | 1.22E-07 | mr1399_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0404657697 | NA | 7.93E-09 | mr1746_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |