\
| Variant ID: vg0404504944 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 4504944 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.71, T: 0.29, others allele: 0.00, population size: 58. )
AACATGCAGACGTATATACTCTCTCCGTTTCGTTTTATTTGACACCGTTGACTTTTTAGCATATGTTTGACCGCTCGTCTTATTCAAAAAATTTAAATAA[T/C]
TATTAATTCTTTTGCTATCATTTGATTCATCGTTAAATATACTTTTATGCATACGTATAGTTTTACATATTTCACCAAAGTTTTTAATAAGACGAACGGT
ACCGTTCGTCTTATTAAAAACTTTGGTGAAATATGTAAAACTATACGTATGCATAAAAGTATATTTAACGATGAATCAAATGATAGCAAAAGAATTAATA[A/G]
TTATTTAAATTTTTTGAATAAGACGAGCGGTCAAACATATGCTAAAAAGTCAACGGTGTCAAATAAAACGAAACGGAGAGAGTATATACGTCTGCATGTT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 45.20% | 23.40% | 7.53% | 23.83% | NA |
| All Indica | 2759 | 53.90% | 6.10% | 11.16% | 28.92% | NA |
| All Japonica | 1512 | 31.50% | 60.40% | 1.72% | 6.42% | NA |
| Aus | 269 | 20.40% | 3.00% | 3.35% | 73.23% | NA |
| Indica I | 595 | 63.20% | 6.70% | 14.29% | 15.80% | NA |
| Indica II | 465 | 18.30% | 4.90% | 15.27% | 61.51% | NA |
| Indica III | 913 | 72.20% | 6.20% | 5.37% | 16.21% | NA |
| Indica Intermediate | 786 | 46.60% | 6.00% | 13.10% | 34.35% | NA |
| Temperate Japonica | 767 | 9.50% | 90.20% | 0.13% | 0.13% | NA |
| Tropical Japonica | 504 | 58.90% | 19.20% | 4.76% | 17.06% | NA |
| Japonica Intermediate | 241 | 44.00% | 51.50% | 0.41% | 4.15% | NA |
| VI/Aromatic | 96 | 87.50% | 0.00% | 4.17% | 8.33% | NA |
| Intermediate | 90 | 41.10% | 20.00% | 10.00% | 28.89% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0404504944 | T -> C | LOC_Os04g08400.1 | downstream_gene_variant ; 1203.0bp to feature; MODIFIER | silent_mutation | Average:48.4; most accessible tissue: Minghui63 panicle, score: 74.563 | N | N | N | N |
| vg0404504944 | T -> C | LOC_Os04g08410.1 | downstream_gene_variant ; 3860.0bp to feature; MODIFIER | silent_mutation | Average:48.4; most accessible tissue: Minghui63 panicle, score: 74.563 | N | N | N | N |
| vg0404504944 | T -> C | LOC_Os04g08400-LOC_Os04g08410 | intergenic_region ; MODIFIER | silent_mutation | Average:48.4; most accessible tissue: Minghui63 panicle, score: 74.563 | N | N | N | N |
| vg0404504944 | T -> DEL | N | N | silent_mutation | Average:48.4; most accessible tissue: Minghui63 panicle, score: 74.563 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0404504944 | NA | 6.40E-06 | mr1164 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0404504944 | NA | 7.23E-09 | mr1194 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0404504944 | 5.97E-06 | NA | mr1698 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0404504944 | NA | 9.76E-06 | mr1329_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0404504944 | 1.13E-06 | NA | mr1549_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0404504944 | NA | 4.19E-06 | mr1566_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0404504944 | 1.20E-06 | NA | mr1698_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0404504944 | NA | 2.34E-06 | mr1698_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0404504944 | NA | 3.61E-06 | mr1730_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0404504944 | NA | 2.15E-07 | mr1743_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0404504944 | 3.54E-07 | NA | mr1757_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0404504944 | NA | 4.30E-11 | mr1851_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0404504944 | NA | 2.38E-07 | mr1860_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0404504944 | NA | 1.58E-07 | mr1866_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0404504944 | NA | 1.87E-09 | mr1905_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |