\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0404463578:

Variant ID: vg0404463578 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 4463578
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ACAGCGGCGAGCCTCGGGCAAGGCAGCGATGACGACGGTGGTGACAGCGGCGGCGGTCACTGGATTAGGGTTTGATTTTTTTGTTTCGATTTTTTATTTT[C/T]
GCGTGCGGGTGCGTCACCCACACGAAAAATCGTATTTTCGCAGACACCTCGTTCCAGACGGGTGGAAGATCCGCACGCGAAAACTGATTCCCACCGCACG

Reverse complement sequence

CGTGCGGTGGGAATCAGTTTTCGCGTGCGGATCTTCCACCCGTCTGGAACGAGGTGTCTGCGAAAATACGATTTTTCGTGTGGGTGACGCACCCGCACGC[G/A]
AAAATAAAAAATCGAAACAAAAAAATCAAACCCTAATCCAGTGACCGCCGCCGCTGTCACCACCGTCGTCATCGCTGCCTTGCCCGAGGCTCGCCGCTGT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 82.40% 10.60% 1.93% 4.99% NA
All Indica  2759 92.10% 1.10% 0.98% 5.87% NA
All Japonica  1512 68.00% 26.80% 0.79% 4.43% NA
Aus  269 90.00% 0.40% 9.67% 0.00% NA
Indica I  595 98.50% 0.00% 1.01% 0.50% NA
Indica II  465 97.80% 0.90% 0.65% 0.65% NA
Indica III  913 88.20% 1.30% 1.64% 8.87% NA
Indica Intermediate  786 88.40% 1.70% 0.38% 9.54% NA
Temperate Japonica  767 89.70% 8.50% 0.00% 1.83% NA
Tropical Japonica  504 37.70% 57.50% 1.19% 3.57% NA
Japonica Intermediate  241 62.20% 20.70% 2.49% 14.52% NA
VI/Aromatic  96 19.80% 55.20% 25.00% 0.00% NA
Intermediate  90 73.30% 16.70% 2.22% 7.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0404463578 C -> DEL N N silent_mutation Average:18.962; most accessible tissue: Zhenshan97 root, score: 30.989 N N N N
vg0404463578 C -> T LOC_Os04g08350.1 upstream_gene_variant ; 1733.0bp to feature; MODIFIER silent_mutation Average:18.962; most accessible tissue: Zhenshan97 root, score: 30.989 N N N N
vg0404463578 C -> T LOC_Os04g08350.2 upstream_gene_variant ; 1733.0bp to feature; MODIFIER silent_mutation Average:18.962; most accessible tissue: Zhenshan97 root, score: 30.989 N N N N
vg0404463578 C -> T LOC_Os04g08350.4 upstream_gene_variant ; 1733.0bp to feature; MODIFIER silent_mutation Average:18.962; most accessible tissue: Zhenshan97 root, score: 30.989 N N N N
vg0404463578 C -> T LOC_Os04g08350.3 upstream_gene_variant ; 1733.0bp to feature; MODIFIER silent_mutation Average:18.962; most accessible tissue: Zhenshan97 root, score: 30.989 N N N N
vg0404463578 C -> T LOC_Os04g08360.1 downstream_gene_variant ; 26.0bp to feature; MODIFIER silent_mutation Average:18.962; most accessible tissue: Zhenshan97 root, score: 30.989 N N N N
vg0404463578 C -> T LOC_Os04g08360-LOC_Os04g08370 intergenic_region ; MODIFIER silent_mutation Average:18.962; most accessible tissue: Zhenshan97 root, score: 30.989 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0404463578 6.50E-08 NA mr1194 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404463578 NA 5.23E-09 mr1194 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404463578 NA 5.65E-07 mr1860_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251