\
| Variant ID: vg0404463578 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 4463578 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
ACAGCGGCGAGCCTCGGGCAAGGCAGCGATGACGACGGTGGTGACAGCGGCGGCGGTCACTGGATTAGGGTTTGATTTTTTTGTTTCGATTTTTTATTTT[C/T]
GCGTGCGGGTGCGTCACCCACACGAAAAATCGTATTTTCGCAGACACCTCGTTCCAGACGGGTGGAAGATCCGCACGCGAAAACTGATTCCCACCGCACG
CGTGCGGTGGGAATCAGTTTTCGCGTGCGGATCTTCCACCCGTCTGGAACGAGGTGTCTGCGAAAATACGATTTTTCGTGTGGGTGACGCACCCGCACGC[G/A]
AAAATAAAAAATCGAAACAAAAAAATCAAACCCTAATCCAGTGACCGCCGCCGCTGTCACCACCGTCGTCATCGCTGCCTTGCCCGAGGCTCGCCGCTGT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 82.40% | 10.60% | 1.93% | 4.99% | NA |
| All Indica | 2759 | 92.10% | 1.10% | 0.98% | 5.87% | NA |
| All Japonica | 1512 | 68.00% | 26.80% | 0.79% | 4.43% | NA |
| Aus | 269 | 90.00% | 0.40% | 9.67% | 0.00% | NA |
| Indica I | 595 | 98.50% | 0.00% | 1.01% | 0.50% | NA |
| Indica II | 465 | 97.80% | 0.90% | 0.65% | 0.65% | NA |
| Indica III | 913 | 88.20% | 1.30% | 1.64% | 8.87% | NA |
| Indica Intermediate | 786 | 88.40% | 1.70% | 0.38% | 9.54% | NA |
| Temperate Japonica | 767 | 89.70% | 8.50% | 0.00% | 1.83% | NA |
| Tropical Japonica | 504 | 37.70% | 57.50% | 1.19% | 3.57% | NA |
| Japonica Intermediate | 241 | 62.20% | 20.70% | 2.49% | 14.52% | NA |
| VI/Aromatic | 96 | 19.80% | 55.20% | 25.00% | 0.00% | NA |
| Intermediate | 90 | 73.30% | 16.70% | 2.22% | 7.78% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0404463578 | C -> DEL | N | N | silent_mutation | Average:18.962; most accessible tissue: Zhenshan97 root, score: 30.989 | N | N | N | N |
| vg0404463578 | C -> T | LOC_Os04g08350.1 | upstream_gene_variant ; 1733.0bp to feature; MODIFIER | silent_mutation | Average:18.962; most accessible tissue: Zhenshan97 root, score: 30.989 | N | N | N | N |
| vg0404463578 | C -> T | LOC_Os04g08350.2 | upstream_gene_variant ; 1733.0bp to feature; MODIFIER | silent_mutation | Average:18.962; most accessible tissue: Zhenshan97 root, score: 30.989 | N | N | N | N |
| vg0404463578 | C -> T | LOC_Os04g08350.4 | upstream_gene_variant ; 1733.0bp to feature; MODIFIER | silent_mutation | Average:18.962; most accessible tissue: Zhenshan97 root, score: 30.989 | N | N | N | N |
| vg0404463578 | C -> T | LOC_Os04g08350.3 | upstream_gene_variant ; 1733.0bp to feature; MODIFIER | silent_mutation | Average:18.962; most accessible tissue: Zhenshan97 root, score: 30.989 | N | N | N | N |
| vg0404463578 | C -> T | LOC_Os04g08360.1 | downstream_gene_variant ; 26.0bp to feature; MODIFIER | silent_mutation | Average:18.962; most accessible tissue: Zhenshan97 root, score: 30.989 | N | N | N | N |
| vg0404463578 | C -> T | LOC_Os04g08360-LOC_Os04g08370 | intergenic_region ; MODIFIER | silent_mutation | Average:18.962; most accessible tissue: Zhenshan97 root, score: 30.989 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0404463578 | 6.50E-08 | NA | mr1194 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0404463578 | NA | 5.23E-09 | mr1194 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0404463578 | NA | 5.65E-07 | mr1860_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |