\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0404447044:

Variant ID: vg0404447044 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 4447044
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.54, A: 0.46, others allele: 0.00, population size: 94. )

Flanking Sequence (100 bp) in Reference Genome:


TTCCGTGCCTTGGACATGTGCTTGACTCAAAAACCTATAAAAGAAAGGAAAAGAGTACTTCAGGATACCGGGAGAAAATTTGCAATTTTGGACAGCATAT[G/A]
AAAAGCATGGGTGCACTAGATAATCATGCTCTGACTGAGATGTTCAACCTAGCAGTGAAAATACTATATCTATGCCATCCATTCGCAAGTAATTCCTGTA

Reverse complement sequence

TACAGGAATTACTTGCGAATGGATGGCATAGATATAGTATTTTCACTGCTAGGTTGAACATCTCAGTCAGAGCATGATTATCTAGTGCACCCATGCTTTT[C/T]
ATATGCTGTCCAAAATTGCAAATTTTCTCCCGGTATCCTGAAGTACTCTTTTCCTTTCTTTTATAGGTTTTTGAGTCAAGCACATGTCCAAGGCACGGAA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 77.30% 22.30% 0.11% 0.28% NA
All Indica  2759 78.90% 20.70% 0.07% 0.36% NA
All Japonica  1512 76.90% 22.90% 0.13% 0.07% NA
Aus  269 57.60% 42.00% 0.00% 0.37% NA
Indica I  595 94.80% 5.00% 0.17% 0.00% NA
Indica II  465 84.90% 14.80% 0.00% 0.22% NA
Indica III  913 69.60% 29.80% 0.00% 0.66% NA
Indica Intermediate  786 74.00% 25.40% 0.13% 0.38% NA
Temperate Japonica  767 95.30% 4.60% 0.13% 0.00% NA
Tropical Japonica  504 65.10% 34.70% 0.00% 0.20% NA
Japonica Intermediate  241 43.20% 56.40% 0.41% 0.00% NA
VI/Aromatic  96 94.80% 5.20% 0.00% 0.00% NA
Intermediate  90 77.80% 20.00% 1.11% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0404447044 G -> DEL N N silent_mutation Average:65.655; most accessible tissue: Callus, score: 82.107 N N N N
vg0404447044 G -> A LOC_Os04g08320.1 upstream_gene_variant ; 3040.0bp to feature; MODIFIER silent_mutation Average:65.655; most accessible tissue: Callus, score: 82.107 N N N N
vg0404447044 G -> A LOC_Os04g08330.1 upstream_gene_variant ; 84.0bp to feature; MODIFIER silent_mutation Average:65.655; most accessible tissue: Callus, score: 82.107 N N N N
vg0404447044 G -> A LOC_Os04g08330-LOC_Os04g08340 intergenic_region ; MODIFIER silent_mutation Average:65.655; most accessible tissue: Callus, score: 82.107 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0404447044 NA 3.33E-06 mr1180 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404447044 NA 3.72E-07 mr1180_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404447044 NA 8.56E-07 mr1183_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404447044 NA 2.59E-06 mr1310_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404447044 NA 8.20E-06 mr1638_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404447044 NA 9.01E-06 mr1740_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404447044 NA 1.04E-08 mr1943_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251