Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0404447044:

Variant ID: vg0404447044 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 4447044
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.54, A: 0.46, others allele: 0.00, population size: 94. )

Flanking Sequence (100 bp) in Reference Genome:

TTCCGTGCCTTGGACATGTGCTTGACTCAAAAACCTATAAAAGAAAGGAAAAGAGTACTTCAGGATACCGGGAGAAAATTTGCAATTTTGGACAGCATAT[G/A]
AAAAGCATGGGTGCACTAGATAATCATGCTCTGACTGAGATGTTCAACCTAGCAGTGAAAATACTATATCTATGCCATCCATTCGCAAGTAATTCCTGTA

Reverse complement sequence

TACAGGAATTACTTGCGAATGGATGGCATAGATATAGTATTTTCACTGCTAGGTTGAACATCTCAGTCAGAGCATGATTATCTAGTGCACCCATGCTTTT[C/T]
ATATGCTGTCCAAAATTGCAAATTTTCTCCCGGTATCCTGAAGTACTCTTTTCCTTTCTTTTATAGGTTTTTGAGTCAAGCACATGTCCAAGGCACGGAA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	77.30%	22.30%	0.11%	0.28%	NA
All Indica	2759	78.90%	20.70%	0.07%	0.36%	NA
All Japonica	1512	76.90%	22.90%	0.13%	0.07%	NA
Aus	269	57.60%	42.00%	0.00%	0.37%	NA
Indica I	595	94.80%	5.00%	0.17%	0.00%	NA
Indica II	465	84.90%	14.80%	0.00%	0.22%	NA
Indica III	913	69.60%	29.80%	0.00%	0.66%	NA
Indica Intermediate	786	74.00%	25.40%	0.13%	0.38%	NA
Temperate Japonica	767	95.30%	4.60%	0.13%	0.00%	NA
Tropical Japonica	504	65.10%	34.70%	0.00%	0.20%	NA
Japonica Intermediate	241	43.20%	56.40%	0.41%	0.00%	NA
VI/Aromatic	96	94.80%	5.20%	0.00%	0.00%	NA
Intermediate	90	77.80%	20.00%	1.11%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0404447044	G -> DEL	N	N	silent_mutation	Average:65.655; most accessible tissue: Callus, score: 82.107	N	N	N	N
vg0404447044	G -> A	LOC_Os04g08320.1	upstream_gene_variant ; 3040.0bp to feature; MODIFIER	silent_mutation	Average:65.655; most accessible tissue: Callus, score: 82.107	N	N	N	N
vg0404447044	G -> A	LOC_Os04g08330.1	upstream_gene_variant ; 84.0bp to feature; MODIFIER	silent_mutation	Average:65.655; most accessible tissue: Callus, score: 82.107	N	N	N	N
vg0404447044	G -> A	LOC_Os04g08330-LOC_Os04g08340	intergenic_region ; MODIFIER	silent_mutation	Average:65.655; most accessible tissue: Callus, score: 82.107	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0404447044	NA	3.33E-06	mr1180	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404447044	NA	3.72E-07	mr1180_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404447044	NA	8.56E-07	mr1183_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404447044	NA	2.59E-06	mr1310_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404447044	NA	8.20E-06	mr1638_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404447044	NA	9.01E-06	mr1740_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404447044	NA	1.04E-08	mr1943_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251