\
| Variant ID: vg0404447044 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 4447044 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.54, A: 0.46, others allele: 0.00, population size: 94. )
TTCCGTGCCTTGGACATGTGCTTGACTCAAAAACCTATAAAAGAAAGGAAAAGAGTACTTCAGGATACCGGGAGAAAATTTGCAATTTTGGACAGCATAT[G/A]
AAAAGCATGGGTGCACTAGATAATCATGCTCTGACTGAGATGTTCAACCTAGCAGTGAAAATACTATATCTATGCCATCCATTCGCAAGTAATTCCTGTA
TACAGGAATTACTTGCGAATGGATGGCATAGATATAGTATTTTCACTGCTAGGTTGAACATCTCAGTCAGAGCATGATTATCTAGTGCACCCATGCTTTT[C/T]
ATATGCTGTCCAAAATTGCAAATTTTCTCCCGGTATCCTGAAGTACTCTTTTCCTTTCTTTTATAGGTTTTTGAGTCAAGCACATGTCCAAGGCACGGAA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 77.30% | 22.30% | 0.11% | 0.28% | NA |
| All Indica | 2759 | 78.90% | 20.70% | 0.07% | 0.36% | NA |
| All Japonica | 1512 | 76.90% | 22.90% | 0.13% | 0.07% | NA |
| Aus | 269 | 57.60% | 42.00% | 0.00% | 0.37% | NA |
| Indica I | 595 | 94.80% | 5.00% | 0.17% | 0.00% | NA |
| Indica II | 465 | 84.90% | 14.80% | 0.00% | 0.22% | NA |
| Indica III | 913 | 69.60% | 29.80% | 0.00% | 0.66% | NA |
| Indica Intermediate | 786 | 74.00% | 25.40% | 0.13% | 0.38% | NA |
| Temperate Japonica | 767 | 95.30% | 4.60% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 65.10% | 34.70% | 0.00% | 0.20% | NA |
| Japonica Intermediate | 241 | 43.20% | 56.40% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 94.80% | 5.20% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 77.80% | 20.00% | 1.11% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0404447044 | G -> DEL | N | N | silent_mutation | Average:65.655; most accessible tissue: Callus, score: 82.107 | N | N | N | N |
| vg0404447044 | G -> A | LOC_Os04g08320.1 | upstream_gene_variant ; 3040.0bp to feature; MODIFIER | silent_mutation | Average:65.655; most accessible tissue: Callus, score: 82.107 | N | N | N | N |
| vg0404447044 | G -> A | LOC_Os04g08330.1 | upstream_gene_variant ; 84.0bp to feature; MODIFIER | silent_mutation | Average:65.655; most accessible tissue: Callus, score: 82.107 | N | N | N | N |
| vg0404447044 | G -> A | LOC_Os04g08330-LOC_Os04g08340 | intergenic_region ; MODIFIER | silent_mutation | Average:65.655; most accessible tissue: Callus, score: 82.107 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0404447044 | NA | 3.33E-06 | mr1180 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0404447044 | NA | 3.72E-07 | mr1180_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0404447044 | NA | 8.56E-07 | mr1183_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0404447044 | NA | 2.59E-06 | mr1310_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0404447044 | NA | 8.20E-06 | mr1638_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0404447044 | NA | 9.01E-06 | mr1740_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0404447044 | NA | 1.04E-08 | mr1943_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |