Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0404438776:

Variant ID: vg0404438776 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 4438776
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.99, others allele: 0.00, population size: 126. )

Flanking Sequence (100 bp) in Reference Genome:

TATAATCATGTTGCATTGTGATATCAGCATGGCTTATCCACGTAATCTAATAGAACATAGTTGTACAGGATTCAGGTCGCACTCTGATTTGGGTATAAAT[A/G]
AACTAATAAACTTGAAAAGTTTTTGTATGAATTTAATATGTATGATGACTTATTGCTACCTTTTGAAGTTTGTTTACTTATAAAGTTATGAAGCTCTATA

Reverse complement sequence

TATAGAGCTTCATAACTTTATAAGTAAACAAACTTCAAAAGGTAGCAATAAGTCATCATACATATTAAATTCATACAAAAACTTTTCAAGTTTATTAGTT[T/C]
ATTTATACCCAAATCAGAGTGCGACCTGAATCCTGTACAACTATGTTCTATTAGATTACGTGGATAAGCCATGCTGATATCACAATGCAACATGATTATA

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	67.90%	15.40%	6.12%	10.56%	NA
All Indica	2759	64.30%	18.40%	6.23%	11.05%	NA
All Japonica	1512	76.10%	12.00%	6.35%	5.56%	NA
Aus	269	52.00%	5.60%	6.69%	35.69%	NA
Indica I	595	93.90%	1.70%	0.17%	4.20%	NA
Indica II	465	40.20%	54.80%	3.87%	1.08%	NA
Indica III	913	64.80%	6.20%	11.72%	17.20%	NA
Indica Intermediate	786	55.30%	23.80%	5.85%	15.01%	NA
Temperate Japonica	767	92.00%	4.00%	3.78%	0.13%	NA
Tropical Japonica	504	68.30%	14.30%	4.56%	12.90%	NA
Japonica Intermediate	241	41.50%	32.80%	18.26%	7.47%	NA
VI/Aromatic	96	91.70%	5.20%	1.04%	2.08%	NA
Intermediate	90	63.30%	21.10%	2.22%	13.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0404438776	A -> DEL	N	N	silent_mutation	Average:52.168; most accessible tissue: Callus, score: 82.288	N	N	N	N
vg0404438776	A -> G	LOC_Os04g08300.1	downstream_gene_variant ; 4937.0bp to feature; MODIFIER	silent_mutation	Average:52.168; most accessible tissue: Callus, score: 82.288	N	N	N	N
vg0404438776	A -> G	LOC_Os04g08320.1	downstream_gene_variant ; 3105.0bp to feature; MODIFIER	silent_mutation	Average:52.168; most accessible tissue: Callus, score: 82.288	N	N	N	N
vg0404438776	A -> G	LOC_Os04g08310.1	intron_variant ; MODIFIER	silent_mutation	Average:52.168; most accessible tissue: Callus, score: 82.288	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0404438776	NA	1.28E-07	mr1035	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404438776	NA	3.47E-08	mr1059	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404438776	NA	3.48E-10	mr1143	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404438776	NA	5.22E-09	mr1167	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404438776	NA	2.20E-07	mr1458	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404438776	NA	9.14E-06	mr1502	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404438776	NA	3.41E-09	mr1535	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404438776	NA	1.35E-07	mr1626	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404438776	NA	4.52E-09	mr1675	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404438776	NA	2.97E-06	mr1904	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404438776	NA	1.82E-06	mr1950	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404438776	NA	5.71E-09	mr1969	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404438776	NA	2.58E-10	mr1995	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404438776	NA	1.25E-09	mr1062_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404438776	NA	6.11E-06	mr1158_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404438776	NA	2.66E-07	mr1158_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404438776	NA	1.08E-07	mr1167_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404438776	NA	6.05E-08	mr1360_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404438776	NA	2.84E-07	mr1360_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404438776	NA	3.23E-07	mr1383_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404438776	NA	8.98E-08	mr1458_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404438776	NA	5.33E-13	mr1715_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404438776	NA	7.62E-08	mr1882_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404438776	NA	6.58E-06	mr1882_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404438776	NA	2.95E-06	mr1895_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251