\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0404438776:

Variant ID: vg0404438776 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 4438776
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.99, others allele: 0.00, population size: 126. )

Flanking Sequence (100 bp) in Reference Genome:


TATAATCATGTTGCATTGTGATATCAGCATGGCTTATCCACGTAATCTAATAGAACATAGTTGTACAGGATTCAGGTCGCACTCTGATTTGGGTATAAAT[A/G]
AACTAATAAACTTGAAAAGTTTTTGTATGAATTTAATATGTATGATGACTTATTGCTACCTTTTGAAGTTTGTTTACTTATAAAGTTATGAAGCTCTATA

Reverse complement sequence

TATAGAGCTTCATAACTTTATAAGTAAACAAACTTCAAAAGGTAGCAATAAGTCATCATACATATTAAATTCATACAAAAACTTTTCAAGTTTATTAGTT[T/C]
ATTTATACCCAAATCAGAGTGCGACCTGAATCCTGTACAACTATGTTCTATTAGATTACGTGGATAAGCCATGCTGATATCACAATGCAACATGATTATA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 67.90% 15.40% 6.12% 10.56% NA
All Indica  2759 64.30% 18.40% 6.23% 11.05% NA
All Japonica  1512 76.10% 12.00% 6.35% 5.56% NA
Aus  269 52.00% 5.60% 6.69% 35.69% NA
Indica I  595 93.90% 1.70% 0.17% 4.20% NA
Indica II  465 40.20% 54.80% 3.87% 1.08% NA
Indica III  913 64.80% 6.20% 11.72% 17.20% NA
Indica Intermediate  786 55.30% 23.80% 5.85% 15.01% NA
Temperate Japonica  767 92.00% 4.00% 3.78% 0.13% NA
Tropical Japonica  504 68.30% 14.30% 4.56% 12.90% NA
Japonica Intermediate  241 41.50% 32.80% 18.26% 7.47% NA
VI/Aromatic  96 91.70% 5.20% 1.04% 2.08% NA
Intermediate  90 63.30% 21.10% 2.22% 13.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0404438776 A -> DEL N N silent_mutation Average:52.168; most accessible tissue: Callus, score: 82.288 N N N N
vg0404438776 A -> G LOC_Os04g08300.1 downstream_gene_variant ; 4937.0bp to feature; MODIFIER silent_mutation Average:52.168; most accessible tissue: Callus, score: 82.288 N N N N
vg0404438776 A -> G LOC_Os04g08320.1 downstream_gene_variant ; 3105.0bp to feature; MODIFIER silent_mutation Average:52.168; most accessible tissue: Callus, score: 82.288 N N N N
vg0404438776 A -> G LOC_Os04g08310.1 intron_variant ; MODIFIER silent_mutation Average:52.168; most accessible tissue: Callus, score: 82.288 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0404438776 NA 1.28E-07 mr1035 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404438776 NA 3.47E-08 mr1059 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404438776 NA 3.48E-10 mr1143 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404438776 NA 5.22E-09 mr1167 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404438776 NA 2.20E-07 mr1458 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404438776 NA 9.14E-06 mr1502 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404438776 NA 3.41E-09 mr1535 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404438776 NA 1.35E-07 mr1626 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404438776 NA 4.52E-09 mr1675 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404438776 NA 2.97E-06 mr1904 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404438776 NA 1.82E-06 mr1950 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404438776 NA 5.71E-09 mr1969 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404438776 NA 2.58E-10 mr1995 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404438776 NA 1.25E-09 mr1062_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404438776 NA 6.11E-06 mr1158_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404438776 NA 2.66E-07 mr1158_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404438776 NA 1.08E-07 mr1167_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404438776 NA 6.05E-08 mr1360_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404438776 NA 2.84E-07 mr1360_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404438776 NA 3.23E-07 mr1383_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404438776 NA 8.98E-08 mr1458_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404438776 NA 5.33E-13 mr1715_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404438776 NA 7.62E-08 mr1882_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404438776 NA 6.58E-06 mr1882_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404438776 NA 2.95E-06 mr1895_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251