\
| Variant ID: vg0404379553 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 4379553 |
| Reference Allele: C | Alternative Allele: T,A |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 96. )
TGGAAACTGCCGGTGCTGGTAATGGAGGGAATAGGCGGCAACTGATTGAAACGGGTGATCGTCGTGGTTGACGATTCCTCCACGCCGGCTCCATCTGCCA[C/T,A]
CGTGGATGCTCTCAGTGTGGTTGGGGATGACAGATCTAGAAGTCACTCATGGCTCCATCCGTTCTAGTGACGCAGCAACCTAGCCGTCACAGGCTAAAAG
CTTTTAGCCTGTGACGGCTAGGTTGCTGCGTCACTAGAACGGATGGAGCCATGAGTGACTTCTAGATCTGTCATCCCCAACCACACTGAGAGCATCCACG[G/A,T]
TGGCAGATGGAGCCGGCGTGGAGGAATCGTCAACCACGACGATCACCCGTTTCAATCAGTTGCCGCCTATTCCCTCCATTACCAGCACCGGCAGTTTCCA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 68.60% | 19.40% | 0.17% | 11.83% | NA |
| All Indica | 2759 | 58.90% | 32.30% | 0.25% | 8.52% | NA |
| All Japonica | 1512 | 87.40% | 0.50% | 0.07% | 12.04% | NA |
| Aus | 269 | 50.20% | 0.00% | 0.00% | 49.81% | NA |
| Indica I | 595 | 5.20% | 90.60% | 0.17% | 4.03% | NA |
| Indica II | 465 | 93.10% | 6.70% | 0.00% | 0.22% | NA |
| Indica III | 913 | 72.50% | 14.50% | 0.33% | 12.71% | NA |
| Indica Intermediate | 786 | 63.50% | 24.20% | 0.38% | 11.96% | NA |
| Temperate Japonica | 767 | 95.70% | 0.10% | 0.00% | 4.17% | NA |
| Tropical Japonica | 504 | 81.20% | 0.40% | 0.20% | 18.25% | NA |
| Japonica Intermediate | 241 | 74.30% | 1.70% | 0.00% | 24.07% | NA |
| VI/Aromatic | 96 | 94.80% | 2.10% | 0.00% | 3.12% | NA |
| Intermediate | 90 | 78.90% | 15.60% | 0.00% | 5.56% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0404379553 | C -> DEL | N | N | silent_mutation | Average:41.636; most accessible tissue: Zhenshan97 flag leaf, score: 71.238 | N | N | N | N |
| vg0404379553 | C -> A | LOC_Os04g08210-LOC_Os04g08230 | intergenic_region ; MODIFIER | N | Average:41.636; most accessible tissue: Zhenshan97 flag leaf, score: 71.238 | N | N | N | N |
| vg0404379553 | C -> T | LOC_Os04g08210-LOC_Os04g08230 | intergenic_region ; MODIFIER | silent_mutation | Average:41.636; most accessible tissue: Zhenshan97 flag leaf, score: 71.238 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0404379553 | NA | 1.89E-06 | mr1715 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0404379553 | NA | 6.62E-06 | mr1036_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0404379553 | NA | 6.94E-10 | mr1062_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0404379553 | NA | 5.50E-06 | mr1265_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0404379553 | NA | 3.48E-06 | mr1360_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0404379553 | NA | 2.39E-06 | mr1527_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0404379553 | NA | 2.86E-06 | mr1659_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0404379553 | NA | 1.80E-12 | mr1715_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0404379553 | NA | 4.70E-08 | mr1758_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0404379553 | NA | 1.64E-07 | mr1842_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0404379553 | NA | 8.09E-07 | mr1895_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0404379553 | NA | 2.70E-09 | mr1902_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |