\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0404353315:

Variant ID: vg0404353315 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 4353315
Reference Allele: TAlternative Allele: C,A
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.97, C: 0.03, others allele: 0.00, population size: 86. )

Flanking Sequence (100 bp) in Reference Genome:


TGGGGCGGCTGGTCAATGGAGATCCTGCTCGGCGCCAGCTTCCTGATGCAGCTTGTGCTGACCTTCTCTGCCGGGTTCCGTTGGCGCGGGGACTCCCCCA[T/C,A]
GCTACGCAACGTCATCTGGCTCTTCTATGTAAGCGGCGACTTTGTGGCGACGCTCGCACTCGGCCACCTCTCTGTAAGTGGCACATCCGGCAAGCGTCGT

Reverse complement sequence

ACGACGCTTGCCGGATGTGCCACTTACAGAGAGGTGGCCGAGTGCGAGCGTCGCCACAAAGTCGCCGCTTACATAGAAGAGCCAGATGACGTTGCGTAGC[A/G,T]
TGGGGGAGTCCCCGCGCCAACGGAACCCGGCAGAGAAGGTCAGCACAAGCTGCATCAGGAAGCTGGCGCCGAGCAGGATCTCCATTGACCAGCCGCCCCA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 75.70% 22.60% 0.36% 1.27% A: 0.04%
All Indica  2759 71.60% 25.70% 0.54% 2.14% NA
All Japonica  1512 94.90% 5.00% 0.07% 0.00% NA
Aus  269 20.80% 78.80% 0.00% 0.37% NA
Indica I  595 97.30% 2.70% 0.00% 0.00% NA
Indica II  465 40.60% 55.30% 0.86% 3.23% NA
Indica III  913 73.10% 24.10% 0.22% 2.63% NA
Indica Intermediate  786 68.70% 27.60% 1.15% 2.54% NA
Temperate Japonica  767 96.20% 3.70% 0.13% 0.00% NA
Tropical Japonica  504 93.10% 6.90% 0.00% 0.00% NA
Japonica Intermediate  241 94.60% 5.40% 0.00% 0.00% NA
VI/Aromatic  96 51.00% 49.00% 0.00% 0.00% NA
Intermediate  90 70.00% 26.70% 1.11% 0.00% A: 2.22%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0404353315 T -> C LOC_Os04g08190.1 missense_variant ; p.Met59Thr; MODERATE nonsynonymous_codon ; M59T Average:70.405; most accessible tissue: Zhenshan97 young leaf, score: 91.689 probably damaging -2.415 TOLERATED 0.37
vg0404353315 T -> DEL LOC_Os04g08190.1 N frameshift_variant Average:70.405; most accessible tissue: Zhenshan97 young leaf, score: 91.689 N N N N
vg0404353315 T -> A LOC_Os04g08190.1 missense_variant ; p.Met59Lys; MODERATE nonsynonymous_codon ; M59K Average:70.405; most accessible tissue: Zhenshan97 young leaf, score: 91.689 probably damaging -2.393 TOLERATED 0.15

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0404353315 NA 2.70E-06 mr1035 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404353315 NA 1.82E-08 mr1059 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404353315 NA 4.65E-06 mr1136 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404353315 NA 1.55E-10 mr1143 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404353315 NA 2.69E-09 mr1167 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404353315 NA 7.55E-06 mr1502 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404353315 NA 1.15E-09 mr1535 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404353315 NA 3.53E-06 mr1626 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404353315 NA 6.84E-10 mr1675 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404353315 NA 1.46E-06 mr1904 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404353315 NA 2.88E-07 mr1950 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404353315 NA 2.80E-09 mr1969 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404353315 NA 5.78E-11 mr1995 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404353315 NA 7.94E-09 mr1062_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404353315 NA 8.34E-06 mr1113_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404353315 NA 7.69E-12 mr1158_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404353315 NA 5.94E-07 mr1158_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404353315 NA 2.66E-07 mr1167_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404353315 NA 2.94E-07 mr1360_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404353315 NA 3.41E-22 mr1715_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404353315 NA 1.69E-13 mr1715_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404353315 NA 8.45E-06 mr1931_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251