Variant ID: vg0404351848 (JBrowse) | Variation Type: SNP |
Chromosome: chr04 | Position: 4351848 |
Reference Allele: A | Alternative Allele: G |
Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
GTTGTTGAAGGCTTTGTTGTTTTGGCATTTCCAAATGTTCCAAGTGATCGCAAGGAGAATTGTGTGCCAAATCCGTTGAATTTTGAACATGCAGGTAATG[A/G]
AAAAATATAAGTTGAAGTAAAGTGGAATTTATTGGTTGGAAAAACCAGCATGATGGAATCATGTAATCCATCTCGTGTATTTGCTTGTAGTAGCAAATTA
TAATTTGCTACTACAAGCAAATACACGAGATGGATTACATGATTCCATCATGCTGGTTTTTCCAACCAATAAATTCCACTTTACTTCAACTTATATTTTT[T/C]
CATTACCTGCATGTTCAAAATTCAACGGATTTGGCACACAATTCTCCTTGCGATCACTTGGAACATTTGGAAATGCCAAAACAACAAAGCCTTCAACAAC
Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 37.90% | 12.60% | 3.62% | 45.83% | NA |
All Indica | 2759 | 11.20% | 18.20% | 5.84% | 64.77% | NA |
All Japonica | 1512 | 89.80% | 0.30% | 0.13% | 9.72% | NA |
Aus | 269 | 16.00% | 26.00% | 1.12% | 56.88% | NA |
Indica I | 595 | 7.10% | 6.90% | 16.97% | 69.08% | NA |
Indica II | 465 | 13.50% | 45.80% | 2.15% | 38.49% | NA |
Indica III | 913 | 6.90% | 8.10% | 1.53% | 83.46% | NA |
Indica Intermediate | 786 | 17.80% | 22.30% | 4.58% | 55.34% | NA |
Temperate Japonica | 767 | 94.90% | 0.40% | 0.13% | 4.56% | NA |
Tropical Japonica | 504 | 90.90% | 0.00% | 0.00% | 9.13% | NA |
Japonica Intermediate | 241 | 71.40% | 0.80% | 0.41% | 27.39% | NA |
VI/Aromatic | 96 | 47.90% | 2.10% | 2.08% | 47.92% | NA |
Intermediate | 90 | 42.20% | 17.80% | 3.33% | 36.67% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg0404351848 | A -> DEL | N | N | silent_mutation | Average:36.938; most accessible tissue: Zhenshan97 young leaf, score: 51.997 | N | N | N | N |
vg0404351848 | A -> G | LOC_Os04g08180.1 | splice_region_variant&intron_variant ; LOW | silent_mutation | Average:36.938; most accessible tissue: Zhenshan97 young leaf, score: 51.997 | N | N | N | N |
vg0404351848 | A -> G | LOC_Os04g08190.1 | upstream_gene_variant ; 1292.0bp to feature; MODIFIER | silent_mutation | Average:36.938; most accessible tissue: Zhenshan97 young leaf, score: 51.997 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg0404351848 | NA | 3.84E-17 | mr1035 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0404351848 | NA | 4.29E-15 | mr1626 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0404351848 | NA | 1.33E-25 | mr1631 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0404351848 | NA | 6.74E-10 | mr1637 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0404351848 | NA | 2.00E-14 | mr1035_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0404351848 | 3.85E-06 | 3.85E-06 | mr1035_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0404351848 | NA | 1.59E-06 | mr1369_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0404351848 | NA | 8.04E-07 | mr1453_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |