\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0404351848:

Variant ID: vg0404351848 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 4351848
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GTTGTTGAAGGCTTTGTTGTTTTGGCATTTCCAAATGTTCCAAGTGATCGCAAGGAGAATTGTGTGCCAAATCCGTTGAATTTTGAACATGCAGGTAATG[A/G]
AAAAATATAAGTTGAAGTAAAGTGGAATTTATTGGTTGGAAAAACCAGCATGATGGAATCATGTAATCCATCTCGTGTATTTGCTTGTAGTAGCAAATTA

Reverse complement sequence

TAATTTGCTACTACAAGCAAATACACGAGATGGATTACATGATTCCATCATGCTGGTTTTTCCAACCAATAAATTCCACTTTACTTCAACTTATATTTTT[T/C]
CATTACCTGCATGTTCAAAATTCAACGGATTTGGCACACAATTCTCCTTGCGATCACTTGGAACATTTGGAAATGCCAAAACAACAAAGCCTTCAACAAC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 37.90% 12.60% 3.62% 45.83% NA
All Indica  2759 11.20% 18.20% 5.84% 64.77% NA
All Japonica  1512 89.80% 0.30% 0.13% 9.72% NA
Aus  269 16.00% 26.00% 1.12% 56.88% NA
Indica I  595 7.10% 6.90% 16.97% 69.08% NA
Indica II  465 13.50% 45.80% 2.15% 38.49% NA
Indica III  913 6.90% 8.10% 1.53% 83.46% NA
Indica Intermediate  786 17.80% 22.30% 4.58% 55.34% NA
Temperate Japonica  767 94.90% 0.40% 0.13% 4.56% NA
Tropical Japonica  504 90.90% 0.00% 0.00% 9.13% NA
Japonica Intermediate  241 71.40% 0.80% 0.41% 27.39% NA
VI/Aromatic  96 47.90% 2.10% 2.08% 47.92% NA
Intermediate  90 42.20% 17.80% 3.33% 36.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0404351848 A -> DEL N N silent_mutation Average:36.938; most accessible tissue: Zhenshan97 young leaf, score: 51.997 N N N N
vg0404351848 A -> G LOC_Os04g08180.1 splice_region_variant&intron_variant ; LOW silent_mutation Average:36.938; most accessible tissue: Zhenshan97 young leaf, score: 51.997 N N N N
vg0404351848 A -> G LOC_Os04g08190.1 upstream_gene_variant ; 1292.0bp to feature; MODIFIER silent_mutation Average:36.938; most accessible tissue: Zhenshan97 young leaf, score: 51.997 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0404351848 NA 3.84E-17 mr1035 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404351848 NA 4.29E-15 mr1626 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404351848 NA 1.33E-25 mr1631 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404351848 NA 6.74E-10 mr1637 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404351848 NA 2.00E-14 mr1035_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404351848 3.85E-06 3.85E-06 mr1035_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404351848 NA 1.59E-06 mr1369_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404351848 NA 8.04E-07 mr1453_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251