\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0404350615:

Variant ID: vg0404350615 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 4350615
Reference Allele: GAlternative Allele: C
Primary Allele: CSecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, C: 0.01, others allele: 0.00, population size: 72. )

Flanking Sequence (100 bp) in Reference Genome:


TCCTGTAACTGACTTCTCTTCTATCATATTTTGCCCTGCTACTTGAAATAAAAATCAGGTACATCCCTTCTTTATGTATAAAATTTCTTTCATTGTAGGT[G/C]
AAAATTTATTTGATTTTAGAATCTTTCTCCTGATTATATGAGACTGTGGTGCTAGATTTTATAACCTGTGAAGATCACAACTGAAAGGCTGAAAGCAATG

Reverse complement sequence

CATTGCTTTCAGCCTTTCAGTTGTGATCTTCACAGGTTATAAAATCTAGCACCACAGTCTCATATAATCAGGAGAAAGATTCTAAAATCAAATAAATTTT[C/G]
ACCTACAATGAAAGAAATTTTATACATAAAGAAGGGATGTACCTGATTTTTATTTCAAGTAGCAGGGCAAAATATGATAGAAGAGAAGTCAGTTACAGGA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 61.80% 38.10% 0.06% 0.00% NA
All Indica  2759 89.10% 10.90% 0.07% 0.00% NA
All Japonica  1512 10.30% 89.70% 0.00% 0.00% NA
Aus  269 77.30% 22.30% 0.37% 0.00% NA
Indica I  595 92.90% 7.10% 0.00% 0.00% NA
Indica II  465 86.50% 13.50% 0.00% 0.00% NA
Indica III  913 93.40% 6.50% 0.11% 0.00% NA
Indica Intermediate  786 82.60% 17.30% 0.13% 0.00% NA
Temperate Japonica  767 5.20% 94.80% 0.00% 0.00% NA
Tropical Japonica  504 9.10% 90.90% 0.00% 0.00% NA
Japonica Intermediate  241 28.60% 71.40% 0.00% 0.00% NA
VI/Aromatic  96 53.10% 46.90% 0.00% 0.00% NA
Intermediate  90 57.80% 42.20% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0404350615 G -> C LOC_Os04g08190.1 upstream_gene_variant ; 2525.0bp to feature; MODIFIER silent_mutation Average:38.127; most accessible tissue: Minghui63 young leaf, score: 49.581 N N N N
vg0404350615 G -> C LOC_Os04g08170.1 downstream_gene_variant ; 4402.0bp to feature; MODIFIER silent_mutation Average:38.127; most accessible tissue: Minghui63 young leaf, score: 49.581 N N N N
vg0404350615 G -> C LOC_Os04g08180.1 intron_variant ; MODIFIER silent_mutation Average:38.127; most accessible tissue: Minghui63 young leaf, score: 49.581 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0404350615 NA 2.94E-16 mr1035 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404350615 NA 6.92E-14 mr1626 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404350615 NA 1.61E-09 mr1637 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404350615 NA 7.79E-14 mr1035_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404350615 3.21E-06 3.21E-06 mr1035_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251