Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0404350615:

Variant ID: vg0404350615 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 4350615
Reference Allele: G	Alternative Allele: C
Primary Allele: C	Secondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, C: 0.01, others allele: 0.00, population size: 72. )

Flanking Sequence (100 bp) in Reference Genome:

TCCTGTAACTGACTTCTCTTCTATCATATTTTGCCCTGCTACTTGAAATAAAAATCAGGTACATCCCTTCTTTATGTATAAAATTTCTTTCATTGTAGGT[G/C]
AAAATTTATTTGATTTTAGAATCTTTCTCCTGATTATATGAGACTGTGGTGCTAGATTTTATAACCTGTGAAGATCACAACTGAAAGGCTGAAAGCAATG

Reverse complement sequence

CATTGCTTTCAGCCTTTCAGTTGTGATCTTCACAGGTTATAAAATCTAGCACCACAGTCTCATATAATCAGGAGAAAGATTCTAAAATCAAATAAATTTT[C/G]
ACCTACAATGAAAGAAATTTTATACATAAAGAAGGGATGTACCTGATTTTTATTTCAAGTAGCAGGGCAAAATATGATAGAAGAGAAGTCAGTTACAGGA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	61.80%	38.10%	0.06%	0.00%	NA
All Indica	2759	89.10%	10.90%	0.07%	0.00%	NA
All Japonica	1512	10.30%	89.70%	0.00%	0.00%	NA
Aus	269	77.30%	22.30%	0.37%	0.00%	NA
Indica I	595	92.90%	7.10%	0.00%	0.00%	NA
Indica II	465	86.50%	13.50%	0.00%	0.00%	NA
Indica III	913	93.40%	6.50%	0.11%	0.00%	NA
Indica Intermediate	786	82.60%	17.30%	0.13%	0.00%	NA
Temperate Japonica	767	5.20%	94.80%	0.00%	0.00%	NA
Tropical Japonica	504	9.10%	90.90%	0.00%	0.00%	NA
Japonica Intermediate	241	28.60%	71.40%	0.00%	0.00%	NA
VI/Aromatic	96	53.10%	46.90%	0.00%	0.00%	NA
Intermediate	90	57.80%	42.20%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0404350615	G -> C	LOC_Os04g08190.1	upstream_gene_variant ; 2525.0bp to feature; MODIFIER	silent_mutation	Average:38.127; most accessible tissue: Minghui63 young leaf, score: 49.581	N	N	N	N
vg0404350615	G -> C	LOC_Os04g08170.1	downstream_gene_variant ; 4402.0bp to feature; MODIFIER	silent_mutation	Average:38.127; most accessible tissue: Minghui63 young leaf, score: 49.581	N	N	N	N
vg0404350615	G -> C	LOC_Os04g08180.1	intron_variant ; MODIFIER	silent_mutation	Average:38.127; most accessible tissue: Minghui63 young leaf, score: 49.581	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0404350615	NA	2.94E-16	mr1035	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404350615	NA	6.92E-14	mr1626	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404350615	NA	1.61E-09	mr1637	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404350615	NA	7.79E-14	mr1035_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404350615	3.21E-06	3.21E-06	mr1035_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251