Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0404270383:

Variant ID: vg0404270383 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 4270383
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.97, T: 0.03, others allele: 0.00, population size: 109. )

Flanking Sequence (100 bp) in Reference Genome:

GAGATTTTTGTGCAAGTACAGCTAGAGTCCCTTGCTGATGCAAGTAGAGAGTACTCCATCCGTCCCAAAATATAACTATTTCTAGCACATTATCTTGTTC[C/T]
AAAATAAAGCTATTTCTTCACCTACCTCCTCCTCTCAACCAATCACAACCATTCTTCTTTACCTACTTTCTCTTTTCAACCAATCACACACTTCCTTCAA

Reverse complement sequence

TTGAAGGAAGTGTGTGATTGGTTGAAAAGAGAAAGTAGGTAAAGAAGAATGGTTGTGATTGGTTGAGAGGAGGAGGTAGGTGAAGAAATAGCTTTATTTT[G/A]
GAACAAGATAATGTGCTAGAAATAGTTATATTTTGGGACGGATGGAGTACTCTCTACTTGCATCAGCAAGGGACTCTAGCTGTACTTGCACAAAAATCTC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	81.20%	16.20%	1.08%	1.52%	NA
All Indica	2759	74.40%	23.50%	1.56%	0.54%	NA
All Japonica	1512	95.00%	4.80%	0.07%	0.13%	NA
Aus	269	64.30%	14.50%	2.23%	18.96%	NA
Indica I	595	99.70%	0.20%	0.17%	0.00%	NA
Indica II	465	78.10%	17.60%	4.30%	0.00%	NA
Indica III	913	54.70%	43.20%	1.31%	0.88%	NA
Indica Intermediate	786	76.20%	21.60%	1.27%	0.89%	NA
Temperate Japonica	767	98.80%	1.20%	0.00%	0.00%	NA
Tropical Japonica	504	97.20%	2.80%	0.00%	0.00%	NA
Japonica Intermediate	241	78.00%	20.70%	0.41%	0.83%	NA
VI/Aromatic	96	97.90%	1.00%	0.00%	1.04%	NA
Intermediate	90	87.80%	7.80%	1.11%	3.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0404270383	C -> DEL	N	N	silent_mutation	Average:60.714; most accessible tissue: Zhenshan97 panicle, score: 87.451	N	N	N	N
vg0404270383	C -> T	LOC_Os04g08010.1	upstream_gene_variant ; 313.0bp to feature; MODIFIER	silent_mutation	Average:60.714; most accessible tissue: Zhenshan97 panicle, score: 87.451	N	N	N	N
vg0404270383	C -> T	LOC_Os04g08034.1	upstream_gene_variant ; 4502.0bp to feature; MODIFIER	silent_mutation	Average:60.714; most accessible tissue: Zhenshan97 panicle, score: 87.451	N	N	N	N
vg0404270383	C -> T	LOC_Os04g08034.2	upstream_gene_variant ; 4502.0bp to feature; MODIFIER	silent_mutation	Average:60.714; most accessible tissue: Zhenshan97 panicle, score: 87.451	N	N	N	N
vg0404270383	C -> T	LOC_Os04g08034.6	upstream_gene_variant ; 4573.0bp to feature; MODIFIER	silent_mutation	Average:60.714; most accessible tissue: Zhenshan97 panicle, score: 87.451	N	N	N	N
vg0404270383	C -> T	LOC_Os04g08034.5	upstream_gene_variant ; 4575.0bp to feature; MODIFIER	silent_mutation	Average:60.714; most accessible tissue: Zhenshan97 panicle, score: 87.451	N	N	N	N
vg0404270383	C -> T	LOC_Os04g08034.3	upstream_gene_variant ; 4575.0bp to feature; MODIFIER	silent_mutation	Average:60.714; most accessible tissue: Zhenshan97 panicle, score: 87.451	N	N	N	N
vg0404270383	C -> T	LOC_Os04g07990-LOC_Os04g08010	intergenic_region ; MODIFIER	silent_mutation	Average:60.714; most accessible tissue: Zhenshan97 panicle, score: 87.451	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0404270383	1.10E-06	NA	mr1167_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404270383	6.98E-06	NA	mr1167_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404270383	1.33E-09	NA	mr1698_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404270383	6.79E-06	3.08E-06	mr1698_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404270383	2.73E-07	NA	mr1726_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404270383	5.43E-07	5.58E-07	mr1726_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251