\
| Variant ID: vg0404270383 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 4270383 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.97, T: 0.03, others allele: 0.00, population size: 109. )
GAGATTTTTGTGCAAGTACAGCTAGAGTCCCTTGCTGATGCAAGTAGAGAGTACTCCATCCGTCCCAAAATATAACTATTTCTAGCACATTATCTTGTTC[C/T]
AAAATAAAGCTATTTCTTCACCTACCTCCTCCTCTCAACCAATCACAACCATTCTTCTTTACCTACTTTCTCTTTTCAACCAATCACACACTTCCTTCAA
TTGAAGGAAGTGTGTGATTGGTTGAAAAGAGAAAGTAGGTAAAGAAGAATGGTTGTGATTGGTTGAGAGGAGGAGGTAGGTGAAGAAATAGCTTTATTTT[G/A]
GAACAAGATAATGTGCTAGAAATAGTTATATTTTGGGACGGATGGAGTACTCTCTACTTGCATCAGCAAGGGACTCTAGCTGTACTTGCACAAAAATCTC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 81.20% | 16.20% | 1.08% | 1.52% | NA |
| All Indica | 2759 | 74.40% | 23.50% | 1.56% | 0.54% | NA |
| All Japonica | 1512 | 95.00% | 4.80% | 0.07% | 0.13% | NA |
| Aus | 269 | 64.30% | 14.50% | 2.23% | 18.96% | NA |
| Indica I | 595 | 99.70% | 0.20% | 0.17% | 0.00% | NA |
| Indica II | 465 | 78.10% | 17.60% | 4.30% | 0.00% | NA |
| Indica III | 913 | 54.70% | 43.20% | 1.31% | 0.88% | NA |
| Indica Intermediate | 786 | 76.20% | 21.60% | 1.27% | 0.89% | NA |
| Temperate Japonica | 767 | 98.80% | 1.20% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 97.20% | 2.80% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 78.00% | 20.70% | 0.41% | 0.83% | NA |
| VI/Aromatic | 96 | 97.90% | 1.00% | 0.00% | 1.04% | NA |
| Intermediate | 90 | 87.80% | 7.80% | 1.11% | 3.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0404270383 | C -> DEL | N | N | silent_mutation | Average:60.714; most accessible tissue: Zhenshan97 panicle, score: 87.451 | N | N | N | N |
| vg0404270383 | C -> T | LOC_Os04g08010.1 | upstream_gene_variant ; 313.0bp to feature; MODIFIER | silent_mutation | Average:60.714; most accessible tissue: Zhenshan97 panicle, score: 87.451 | N | N | N | N |
| vg0404270383 | C -> T | LOC_Os04g08034.1 | upstream_gene_variant ; 4502.0bp to feature; MODIFIER | silent_mutation | Average:60.714; most accessible tissue: Zhenshan97 panicle, score: 87.451 | N | N | N | N |
| vg0404270383 | C -> T | LOC_Os04g08034.2 | upstream_gene_variant ; 4502.0bp to feature; MODIFIER | silent_mutation | Average:60.714; most accessible tissue: Zhenshan97 panicle, score: 87.451 | N | N | N | N |
| vg0404270383 | C -> T | LOC_Os04g08034.6 | upstream_gene_variant ; 4573.0bp to feature; MODIFIER | silent_mutation | Average:60.714; most accessible tissue: Zhenshan97 panicle, score: 87.451 | N | N | N | N |
| vg0404270383 | C -> T | LOC_Os04g08034.5 | upstream_gene_variant ; 4575.0bp to feature; MODIFIER | silent_mutation | Average:60.714; most accessible tissue: Zhenshan97 panicle, score: 87.451 | N | N | N | N |
| vg0404270383 | C -> T | LOC_Os04g08034.3 | upstream_gene_variant ; 4575.0bp to feature; MODIFIER | silent_mutation | Average:60.714; most accessible tissue: Zhenshan97 panicle, score: 87.451 | N | N | N | N |
| vg0404270383 | C -> T | LOC_Os04g07990-LOC_Os04g08010 | intergenic_region ; MODIFIER | silent_mutation | Average:60.714; most accessible tissue: Zhenshan97 panicle, score: 87.451 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0404270383 | 1.10E-06 | NA | mr1167_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0404270383 | 6.98E-06 | NA | mr1167_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0404270383 | 1.33E-09 | NA | mr1698_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0404270383 | 6.79E-06 | 3.08E-06 | mr1698_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0404270383 | 2.73E-07 | NA | mr1726_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0404270383 | 5.43E-07 | 5.58E-07 | mr1726_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |