\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0404270383:

Variant ID: vg0404270383 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 4270383
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.97, T: 0.03, others allele: 0.00, population size: 109. )

Flanking Sequence (100 bp) in Reference Genome:


GAGATTTTTGTGCAAGTACAGCTAGAGTCCCTTGCTGATGCAAGTAGAGAGTACTCCATCCGTCCCAAAATATAACTATTTCTAGCACATTATCTTGTTC[C/T]
AAAATAAAGCTATTTCTTCACCTACCTCCTCCTCTCAACCAATCACAACCATTCTTCTTTACCTACTTTCTCTTTTCAACCAATCACACACTTCCTTCAA

Reverse complement sequence

TTGAAGGAAGTGTGTGATTGGTTGAAAAGAGAAAGTAGGTAAAGAAGAATGGTTGTGATTGGTTGAGAGGAGGAGGTAGGTGAAGAAATAGCTTTATTTT[G/A]
GAACAAGATAATGTGCTAGAAATAGTTATATTTTGGGACGGATGGAGTACTCTCTACTTGCATCAGCAAGGGACTCTAGCTGTACTTGCACAAAAATCTC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 81.20% 16.20% 1.08% 1.52% NA
All Indica  2759 74.40% 23.50% 1.56% 0.54% NA
All Japonica  1512 95.00% 4.80% 0.07% 0.13% NA
Aus  269 64.30% 14.50% 2.23% 18.96% NA
Indica I  595 99.70% 0.20% 0.17% 0.00% NA
Indica II  465 78.10% 17.60% 4.30% 0.00% NA
Indica III  913 54.70% 43.20% 1.31% 0.88% NA
Indica Intermediate  786 76.20% 21.60% 1.27% 0.89% NA
Temperate Japonica  767 98.80% 1.20% 0.00% 0.00% NA
Tropical Japonica  504 97.20% 2.80% 0.00% 0.00% NA
Japonica Intermediate  241 78.00% 20.70% 0.41% 0.83% NA
VI/Aromatic  96 97.90% 1.00% 0.00% 1.04% NA
Intermediate  90 87.80% 7.80% 1.11% 3.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0404270383 C -> DEL N N silent_mutation Average:60.714; most accessible tissue: Zhenshan97 panicle, score: 87.451 N N N N
vg0404270383 C -> T LOC_Os04g08010.1 upstream_gene_variant ; 313.0bp to feature; MODIFIER silent_mutation Average:60.714; most accessible tissue: Zhenshan97 panicle, score: 87.451 N N N N
vg0404270383 C -> T LOC_Os04g08034.1 upstream_gene_variant ; 4502.0bp to feature; MODIFIER silent_mutation Average:60.714; most accessible tissue: Zhenshan97 panicle, score: 87.451 N N N N
vg0404270383 C -> T LOC_Os04g08034.2 upstream_gene_variant ; 4502.0bp to feature; MODIFIER silent_mutation Average:60.714; most accessible tissue: Zhenshan97 panicle, score: 87.451 N N N N
vg0404270383 C -> T LOC_Os04g08034.6 upstream_gene_variant ; 4573.0bp to feature; MODIFIER silent_mutation Average:60.714; most accessible tissue: Zhenshan97 panicle, score: 87.451 N N N N
vg0404270383 C -> T LOC_Os04g08034.5 upstream_gene_variant ; 4575.0bp to feature; MODIFIER silent_mutation Average:60.714; most accessible tissue: Zhenshan97 panicle, score: 87.451 N N N N
vg0404270383 C -> T LOC_Os04g08034.3 upstream_gene_variant ; 4575.0bp to feature; MODIFIER silent_mutation Average:60.714; most accessible tissue: Zhenshan97 panicle, score: 87.451 N N N N
vg0404270383 C -> T LOC_Os04g07990-LOC_Os04g08010 intergenic_region ; MODIFIER silent_mutation Average:60.714; most accessible tissue: Zhenshan97 panicle, score: 87.451 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0404270383 1.10E-06 NA mr1167_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404270383 6.98E-06 NA mr1167_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404270383 1.33E-09 NA mr1698_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404270383 6.79E-06 3.08E-06 mr1698_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404270383 2.73E-07 NA mr1726_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404270383 5.43E-07 5.58E-07 mr1726_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251