\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0404029438:

Variant ID: vg0404029438 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 4029438
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GAAGAGAAGAACACACGCGAGAAGTTTTTGTGCCGCCAAACTTACGCAGCTTTTCTGTGTATTTCATCACCATTTATACAAAGTGAAAACGAGATCATGC[G/A]
ATCGTGTAGATCATGTCTCCGACTCTGTGCACTCCCACGAACTCCATTTGCGCATGTGCCATCCCACACGGCGAAGAACGTGAGCGTACGACTCGCTACA

Reverse complement sequence

TGTAGCGAGTCGTACGCTCACGTTCTTCGCCGTGTGGGATGGCACATGCGCAAATGGAGTTCGTGGGAGTGCACAGAGTCGGAGACATGATCTACACGAT[C/T]
GCATGATCTCGTTTTCACTTTGTATAAATGGTGATGAAATACACAGAAAAGCTGCGTAAGTTTGGCGGCACAAAAACTTCTCGCGTGTGTTCTTCTCTTC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 81.30% 0.20% 2.62% 15.91% NA
All Indica  2759 73.00% 0.30% 4.17% 22.54% NA
All Japonica  1512 95.80% 0.00% 0.13% 4.10% NA
Aus  269 77.70% 0.00% 1.86% 20.45% NA
Indica I  595 61.70% 0.70% 6.89% 30.76% NA
Indica II  465 72.70% 0.40% 3.44% 23.44% NA
Indica III  913 80.60% 0.00% 2.96% 16.43% NA
Indica Intermediate  786 72.90% 0.30% 3.94% 22.90% NA
Temperate Japonica  767 99.90% 0.00% 0.00% 0.13% NA
Tropical Japonica  504 89.30% 0.00% 0.40% 10.32% NA
Japonica Intermediate  241 96.30% 0.00% 0.00% 3.73% NA
VI/Aromatic  96 97.90% 0.00% 1.04% 1.04% NA
Intermediate  90 85.60% 0.00% 1.11% 13.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0404029438 G -> DEL N N silent_mutation Average:34.738; most accessible tissue: Minghui63 young leaf, score: 65.92 N N N N
vg0404029438 G -> A LOC_Os04g07570.1 downstream_gene_variant ; 3758.0bp to feature; MODIFIER silent_mutation Average:34.738; most accessible tissue: Minghui63 young leaf, score: 65.92 N N N N
vg0404029438 G -> A LOC_Os04g07580.1 intron_variant ; MODIFIER silent_mutation Average:34.738; most accessible tissue: Minghui63 young leaf, score: 65.92 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0404029438 4.29E-06 4.29E-06 mr1049_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404029438 8.26E-06 2.37E-06 mr1245_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404029438 NA 3.17E-06 mr1295_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404029438 3.74E-06 3.75E-06 mr1311_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404029438 2.10E-06 2.10E-06 mr1311_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404029438 5.63E-06 5.62E-06 mr1329_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404029438 NA 5.59E-06 mr1445_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404029438 4.20E-06 NA mr1524_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404029438 9.54E-06 9.54E-06 mr1524_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404029438 NA 9.83E-06 mr1607_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404029438 5.69E-06 9.68E-07 mr1663_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404029438 4.25E-06 4.26E-06 mr1674_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404029438 3.78E-06 3.78E-06 mr1674_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404029438 5.90E-06 5.89E-06 mr1843_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404029438 8.67E-06 8.68E-06 mr1847_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404029438 3.27E-06 3.27E-06 mr1891_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404029438 7.29E-06 7.29E-06 mr1982_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251