\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0404020580:

Variant ID: vg0404020580 (JBrowse)Variation Type: INDEL
Chromosome: chr04Position: 4020580
Reference Allele: GAlternative Allele: C,A,GC
Primary Allele: GSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TGATCTCGGGACATCGGGGTGAGTCCGTTATAAAAGTTCTGCAGGATCAGCCAGTCATCCATCCAATGATGAGGACAGGCGGCCACATACTCCTACAGTC[G/C,A,GC]
TTCCCATGCTTCCAGAATAGACTCGTCCCTCATCTGCTGGAAACTTGAAATCCTTCCACGAAGGGCATTGGTTTTGCCCATCGGGAAGAATTTCGAGAGG

Reverse complement sequence

CCTCTCGAAATTCTTCCCGATGGGCAAAACCAATGCCCTTCGTGGAAGGATTTCAAGTTTCCAGCAGATGAGGGACGAGTCTATTCTGGAAGCATGGGAA[C/G,T,GC]
GACTGTAGGAGTATGTGGCCGCCTGTCCTCATCATTGGATGGATGACTGGCTGATCCTGCAGAACTTTTATAACGGACTCACCCCGATGTCCCGAGATCA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 93.70% 0.20% 1.23% 4.78% A: 0.08%; GC: 0.04%
All Indica  2759 90.60% 0.30% 1.45% 7.43% A: 0.14%; GC: 0.07%
All Japonica  1512 98.40% 0.20% 0.93% 0.46% NA
Aus  269 95.50% 0.00% 0.74% 3.72% NA
Indica I  595 87.70% 0.00% 1.01% 11.26% NA
Indica II  465 95.10% 0.00% 1.94% 2.80% A: 0.22%
Indica III  913 88.80% 0.50% 2.08% 8.32% GC: 0.22%
Indica Intermediate  786 92.40% 0.30% 0.76% 6.23% A: 0.38%
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 96.00% 0.60% 2.38% 0.99% NA
Japonica Intermediate  241 98.30% 0.00% 0.83% 0.83% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 93.30% 0.00% 2.22% 4.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0404020580 G -> C LOC_Os04g07550.1 upstream_gene_variant ; 225.0bp to feature; MODIFIER silent_mutation Average:40.424; most accessible tissue: Minghui63 young leaf, score: 82.087 N N N N
vg0404020580 G -> C LOC_Os04g07570.1 upstream_gene_variant ; 3173.0bp to feature; MODIFIER silent_mutation Average:40.424; most accessible tissue: Minghui63 young leaf, score: 82.087 N N N N
vg0404020580 G -> C LOC_Os04g07560.1 downstream_gene_variant ; 157.0bp to feature; MODIFIER silent_mutation Average:40.424; most accessible tissue: Minghui63 young leaf, score: 82.087 N N N N
vg0404020580 G -> C LOC_Os04g07550-LOC_Os04g07560 intergenic_region ; MODIFIER silent_mutation Average:40.424; most accessible tissue: Minghui63 young leaf, score: 82.087 N N N N
vg0404020580 G -> DEL N N silent_mutation Average:40.424; most accessible tissue: Minghui63 young leaf, score: 82.087 N N N N
vg0404020580 G -> GC LOC_Os04g07550.1 upstream_gene_variant ; 226.0bp to feature; MODIFIER silent_mutation Average:40.424; most accessible tissue: Minghui63 young leaf, score: 82.087 N N N N
vg0404020580 G -> GC LOC_Os04g07570.1 upstream_gene_variant ; 3172.0bp to feature; MODIFIER silent_mutation Average:40.424; most accessible tissue: Minghui63 young leaf, score: 82.087 N N N N
vg0404020580 G -> GC LOC_Os04g07560.1 downstream_gene_variant ; 156.0bp to feature; MODIFIER silent_mutation Average:40.424; most accessible tissue: Minghui63 young leaf, score: 82.087 N N N N
vg0404020580 G -> GC LOC_Os04g07550-LOC_Os04g07560 intergenic_region ; MODIFIER silent_mutation Average:40.424; most accessible tissue: Minghui63 young leaf, score: 82.087 N N N N
vg0404020580 G -> A LOC_Os04g07550.1 upstream_gene_variant ; 225.0bp to feature; MODIFIER silent_mutation Average:40.424; most accessible tissue: Minghui63 young leaf, score: 82.087 N N N N
vg0404020580 G -> A LOC_Os04g07570.1 upstream_gene_variant ; 3173.0bp to feature; MODIFIER silent_mutation Average:40.424; most accessible tissue: Minghui63 young leaf, score: 82.087 N N N N
vg0404020580 G -> A LOC_Os04g07560.1 downstream_gene_variant ; 157.0bp to feature; MODIFIER silent_mutation Average:40.424; most accessible tissue: Minghui63 young leaf, score: 82.087 N N N N
vg0404020580 G -> A LOC_Os04g07550-LOC_Os04g07560 intergenic_region ; MODIFIER silent_mutation Average:40.424; most accessible tissue: Minghui63 young leaf, score: 82.087 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0404020580 3.10E-07 2.91E-07 mr1008 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404020580 2.74E-06 2.36E-06 mr1009 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404020580 7.66E-06 NA mr1014 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251