\
| Variant ID: vg0404020580 (JBrowse) | Variation Type: INDEL |
| Chromosome: chr04 | Position: 4020580 |
| Reference Allele: G | Alternative Allele: C,A,GC |
| Primary Allele: G | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
TGATCTCGGGACATCGGGGTGAGTCCGTTATAAAAGTTCTGCAGGATCAGCCAGTCATCCATCCAATGATGAGGACAGGCGGCCACATACTCCTACAGTC[G/C,A,GC]
TTCCCATGCTTCCAGAATAGACTCGTCCCTCATCTGCTGGAAACTTGAAATCCTTCCACGAAGGGCATTGGTTTTGCCCATCGGGAAGAATTTCGAGAGG
CCTCTCGAAATTCTTCCCGATGGGCAAAACCAATGCCCTTCGTGGAAGGATTTCAAGTTTCCAGCAGATGAGGGACGAGTCTATTCTGGAAGCATGGGAA[C/G,T,GC]
GACTGTAGGAGTATGTGGCCGCCTGTCCTCATCATTGGATGGATGACTGGCTGATCCTGCAGAACTTTTATAACGGACTCACCCCGATGTCCCGAGATCA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 93.70% | 0.20% | 1.23% | 4.78% | A: 0.08%; GC: 0.04% |
| All Indica | 2759 | 90.60% | 0.30% | 1.45% | 7.43% | A: 0.14%; GC: 0.07% |
| All Japonica | 1512 | 98.40% | 0.20% | 0.93% | 0.46% | NA |
| Aus | 269 | 95.50% | 0.00% | 0.74% | 3.72% | NA |
| Indica I | 595 | 87.70% | 0.00% | 1.01% | 11.26% | NA |
| Indica II | 465 | 95.10% | 0.00% | 1.94% | 2.80% | A: 0.22% |
| Indica III | 913 | 88.80% | 0.50% | 2.08% | 8.32% | GC: 0.22% |
| Indica Intermediate | 786 | 92.40% | 0.30% | 0.76% | 6.23% | A: 0.38% |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 96.00% | 0.60% | 2.38% | 0.99% | NA |
| Japonica Intermediate | 241 | 98.30% | 0.00% | 0.83% | 0.83% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 93.30% | 0.00% | 2.22% | 4.44% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0404020580 | G -> C | LOC_Os04g07550.1 | upstream_gene_variant ; 225.0bp to feature; MODIFIER | silent_mutation | Average:40.424; most accessible tissue: Minghui63 young leaf, score: 82.087 | N | N | N | N |
| vg0404020580 | G -> C | LOC_Os04g07570.1 | upstream_gene_variant ; 3173.0bp to feature; MODIFIER | silent_mutation | Average:40.424; most accessible tissue: Minghui63 young leaf, score: 82.087 | N | N | N | N |
| vg0404020580 | G -> C | LOC_Os04g07560.1 | downstream_gene_variant ; 157.0bp to feature; MODIFIER | silent_mutation | Average:40.424; most accessible tissue: Minghui63 young leaf, score: 82.087 | N | N | N | N |
| vg0404020580 | G -> C | LOC_Os04g07550-LOC_Os04g07560 | intergenic_region ; MODIFIER | silent_mutation | Average:40.424; most accessible tissue: Minghui63 young leaf, score: 82.087 | N | N | N | N |
| vg0404020580 | G -> DEL | N | N | silent_mutation | Average:40.424; most accessible tissue: Minghui63 young leaf, score: 82.087 | N | N | N | N |
| vg0404020580 | G -> GC | LOC_Os04g07550.1 | upstream_gene_variant ; 226.0bp to feature; MODIFIER | silent_mutation | Average:40.424; most accessible tissue: Minghui63 young leaf, score: 82.087 | N | N | N | N |
| vg0404020580 | G -> GC | LOC_Os04g07570.1 | upstream_gene_variant ; 3172.0bp to feature; MODIFIER | silent_mutation | Average:40.424; most accessible tissue: Minghui63 young leaf, score: 82.087 | N | N | N | N |
| vg0404020580 | G -> GC | LOC_Os04g07560.1 | downstream_gene_variant ; 156.0bp to feature; MODIFIER | silent_mutation | Average:40.424; most accessible tissue: Minghui63 young leaf, score: 82.087 | N | N | N | N |
| vg0404020580 | G -> GC | LOC_Os04g07550-LOC_Os04g07560 | intergenic_region ; MODIFIER | silent_mutation | Average:40.424; most accessible tissue: Minghui63 young leaf, score: 82.087 | N | N | N | N |
| vg0404020580 | G -> A | LOC_Os04g07550.1 | upstream_gene_variant ; 225.0bp to feature; MODIFIER | silent_mutation | Average:40.424; most accessible tissue: Minghui63 young leaf, score: 82.087 | N | N | N | N |
| vg0404020580 | G -> A | LOC_Os04g07570.1 | upstream_gene_variant ; 3173.0bp to feature; MODIFIER | silent_mutation | Average:40.424; most accessible tissue: Minghui63 young leaf, score: 82.087 | N | N | N | N |
| vg0404020580 | G -> A | LOC_Os04g07560.1 | downstream_gene_variant ; 157.0bp to feature; MODIFIER | silent_mutation | Average:40.424; most accessible tissue: Minghui63 young leaf, score: 82.087 | N | N | N | N |
| vg0404020580 | G -> A | LOC_Os04g07550-LOC_Os04g07560 | intergenic_region ; MODIFIER | silent_mutation | Average:40.424; most accessible tissue: Minghui63 young leaf, score: 82.087 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0404020580 | 3.10E-07 | 2.91E-07 | mr1008 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0404020580 | 2.74E-06 | 2.36E-06 | mr1009 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0404020580 | 7.66E-06 | NA | mr1014 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |