Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0403954770:

Variant ID: vg0403954770 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 3954770
Reference Allele: G	Alternative Allele: T,A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.01, A: 0.00, others allele: 0.00, population size: 204. )

Flanking Sequence (100 bp) in Reference Genome:

TAGTGTTTGGTTATGCAATTACTCTATGTCATGACGATGATACTAGAGTAGTTTCTGGTAGTTTAGGCGTGGTGTCTAGATTACGGGATATCATTATTTT[G/T,A]
GGTTATATGCTGCAGATGAGACGTGGGCCGCTGATGGTGACGGCTCAGTATGGGTATTCCTCCGCGCGTGTATATAGTCCTAAGTTAATTTCCTGGGGAG

Reverse complement sequence

CTCCCCAGGAAATTAACTTAGGACTATATACACGCGCGGAGGAATACCCATACTGAGCCGTCACCATCAGCGGCCCACGTCTCATCTGCAGCATATAACC[C/A,T]
AAAATAATGATATCCCGTAATCTAGACACCACGCCTAAACTACCAGAAACTACTCTAGTATCATCGTCATGACATAGAGTAATTGCATAACCAAACACTA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	73.70%	15.80%	2.07%	2.56%	T: 5.92%
All Indica	2759	65.00%	24.70%	3.19%	3.37%	T: 3.77%
All Japonica	1512	97.20%	1.30%	0.00%	0.00%	T: 1.52%
Aus	269	51.70%	13.00%	1.86%	7.81%	T: 25.65%
Indica I	595	98.80%	0.30%	0.17%	0.17%	T: 0.50%
Indica II	465	77.60%	3.00%	3.66%	4.73%	T: 10.97%
Indica III	913	35.30%	52.90%	6.02%	4.49%	T: 1.31%
Indica Intermediate	786	66.40%	23.20%	1.91%	3.69%	T: 4.83%
Temperate Japonica	767	99.70%	0.00%	0.00%	0.00%	T: 0.26%
Tropical Japonica	504	93.50%	3.00%	0.00%	0.00%	T: 3.57%
Japonica Intermediate	241	96.70%	2.10%	0.00%	0.00%	T: 1.24%
VI/Aromatic	96	15.60%	1.00%	2.08%	4.17%	T: 77.08%
Intermediate	90	73.30%	8.90%	3.33%	3.33%	T: 11.11%

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0403954770	G -> DEL	N	N	silent_mutation	Average:48.278; most accessible tissue: Zhenshan97 young leaf, score: 76.099	N	N	N	N
vg0403954770	G -> A	LOC_Os04g07430.1	downstream_gene_variant ; 4546.0bp to feature; MODIFIER	silent_mutation	Average:48.278; most accessible tissue: Zhenshan97 young leaf, score: 76.099	N	N	N	N
vg0403954770	G -> A	LOC_Os04g07440.1	downstream_gene_variant ; 2604.0bp to feature; MODIFIER	silent_mutation	Average:48.278; most accessible tissue: Zhenshan97 young leaf, score: 76.099	N	N	N	N
vg0403954770	G -> A	LOC_Os04g07450.1	downstream_gene_variant ; 2039.0bp to feature; MODIFIER	silent_mutation	Average:48.278; most accessible tissue: Zhenshan97 young leaf, score: 76.099	N	N	N	N
vg0403954770	G -> A	LOC_Os04g07460.1	downstream_gene_variant ; 4473.0bp to feature; MODIFIER	silent_mutation	Average:48.278; most accessible tissue: Zhenshan97 young leaf, score: 76.099	N	N	N	N
vg0403954770	G -> A	LOC_Os04g07440-LOC_Os04g07450	intergenic_region ; MODIFIER	silent_mutation	Average:48.278; most accessible tissue: Zhenshan97 young leaf, score: 76.099	N	N	N	N
vg0403954770	G -> T	LOC_Os04g07430.1	downstream_gene_variant ; 4546.0bp to feature; MODIFIER	silent_mutation	Average:48.278; most accessible tissue: Zhenshan97 young leaf, score: 76.099	N	N	N	N
vg0403954770	G -> T	LOC_Os04g07440.1	downstream_gene_variant ; 2604.0bp to feature; MODIFIER	silent_mutation	Average:48.278; most accessible tissue: Zhenshan97 young leaf, score: 76.099	N	N	N	N
vg0403954770	G -> T	LOC_Os04g07450.1	downstream_gene_variant ; 2039.0bp to feature; MODIFIER	silent_mutation	Average:48.278; most accessible tissue: Zhenshan97 young leaf, score: 76.099	N	N	N	N
vg0403954770	G -> T	LOC_Os04g07460.1	downstream_gene_variant ; 4473.0bp to feature; MODIFIER	silent_mutation	Average:48.278; most accessible tissue: Zhenshan97 young leaf, score: 76.099	N	N	N	N
vg0403954770	G -> T	LOC_Os04g07440-LOC_Os04g07450	intergenic_region ; MODIFIER	silent_mutation	Average:48.278; most accessible tissue: Zhenshan97 young leaf, score: 76.099	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0403954770	NA	1.50E-06	mr1037	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403954770	NA	4.53E-09	mr1068	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403954770	NA	9.23E-08	mr1094	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403954770	NA	3.80E-07	mr1096	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403954770	NA	6.11E-07	mr1111	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403954770	NA	2.03E-08	mr1112	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403954770	NA	1.32E-07	mr1133	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403954770	NA	1.67E-08	mr1144	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403954770	NA	3.15E-07	mr1155	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403954770	NA	6.65E-10	mr1213	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403954770	NA	9.96E-07	mr1237	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403954770	NA	1.41E-07	mr1244	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403954770	NA	1.20E-06	mr1561	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403954770	NA	1.68E-06	mr1796	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403954770	NA	3.34E-08	mr1798	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403954770	NA	1.06E-06	mr1094_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403954770	NA	6.90E-07	mr1096_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403954770	NA	2.46E-07	mr1111_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403954770	NA	2.04E-06	mr1121_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403954770	NA	1.08E-06	mr1133_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403954770	NA	4.60E-07	mr1144_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403954770	NA	1.06E-08	mr1155_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403954770	NA	4.21E-07	mr1244_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403954770	NA	6.32E-06	mr1561_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403954770	5.59E-06	NA	mr1798_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403954770	6.59E-06	3.51E-17	mr1798_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403954770	NA	5.10E-06	mr1971_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251