\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0403954770:

Variant ID: vg0403954770 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 3954770
Reference Allele: GAlternative Allele: T,A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.01, A: 0.00, others allele: 0.00, population size: 204. )

Flanking Sequence (100 bp) in Reference Genome:


TAGTGTTTGGTTATGCAATTACTCTATGTCATGACGATGATACTAGAGTAGTTTCTGGTAGTTTAGGCGTGGTGTCTAGATTACGGGATATCATTATTTT[G/T,A]
GGTTATATGCTGCAGATGAGACGTGGGCCGCTGATGGTGACGGCTCAGTATGGGTATTCCTCCGCGCGTGTATATAGTCCTAAGTTAATTTCCTGGGGAG

Reverse complement sequence

CTCCCCAGGAAATTAACTTAGGACTATATACACGCGCGGAGGAATACCCATACTGAGCCGTCACCATCAGCGGCCCACGTCTCATCTGCAGCATATAACC[C/A,T]
AAAATAATGATATCCCGTAATCTAGACACCACGCCTAAACTACCAGAAACTACTCTAGTATCATCGTCATGACATAGAGTAATTGCATAACCAAACACTA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 73.70% 15.80% 2.07% 2.56% T: 5.92%
All Indica  2759 65.00% 24.70% 3.19% 3.37% T: 3.77%
All Japonica  1512 97.20% 1.30% 0.00% 0.00% T: 1.52%
Aus  269 51.70% 13.00% 1.86% 7.81% T: 25.65%
Indica I  595 98.80% 0.30% 0.17% 0.17% T: 0.50%
Indica II  465 77.60% 3.00% 3.66% 4.73% T: 10.97%
Indica III  913 35.30% 52.90% 6.02% 4.49% T: 1.31%
Indica Intermediate  786 66.40% 23.20% 1.91% 3.69% T: 4.83%
Temperate Japonica  767 99.70% 0.00% 0.00% 0.00% T: 0.26%
Tropical Japonica  504 93.50% 3.00% 0.00% 0.00% T: 3.57%
Japonica Intermediate  241 96.70% 2.10% 0.00% 0.00% T: 1.24%
VI/Aromatic  96 15.60% 1.00% 2.08% 4.17% T: 77.08%
Intermediate  90 73.30% 8.90% 3.33% 3.33% T: 11.11%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0403954770 G -> DEL N N silent_mutation Average:48.278; most accessible tissue: Zhenshan97 young leaf, score: 76.099 N N N N
vg0403954770 G -> A LOC_Os04g07430.1 downstream_gene_variant ; 4546.0bp to feature; MODIFIER silent_mutation Average:48.278; most accessible tissue: Zhenshan97 young leaf, score: 76.099 N N N N
vg0403954770 G -> A LOC_Os04g07440.1 downstream_gene_variant ; 2604.0bp to feature; MODIFIER silent_mutation Average:48.278; most accessible tissue: Zhenshan97 young leaf, score: 76.099 N N N N
vg0403954770 G -> A LOC_Os04g07450.1 downstream_gene_variant ; 2039.0bp to feature; MODIFIER silent_mutation Average:48.278; most accessible tissue: Zhenshan97 young leaf, score: 76.099 N N N N
vg0403954770 G -> A LOC_Os04g07460.1 downstream_gene_variant ; 4473.0bp to feature; MODIFIER silent_mutation Average:48.278; most accessible tissue: Zhenshan97 young leaf, score: 76.099 N N N N
vg0403954770 G -> A LOC_Os04g07440-LOC_Os04g07450 intergenic_region ; MODIFIER silent_mutation Average:48.278; most accessible tissue: Zhenshan97 young leaf, score: 76.099 N N N N
vg0403954770 G -> T LOC_Os04g07430.1 downstream_gene_variant ; 4546.0bp to feature; MODIFIER silent_mutation Average:48.278; most accessible tissue: Zhenshan97 young leaf, score: 76.099 N N N N
vg0403954770 G -> T LOC_Os04g07440.1 downstream_gene_variant ; 2604.0bp to feature; MODIFIER silent_mutation Average:48.278; most accessible tissue: Zhenshan97 young leaf, score: 76.099 N N N N
vg0403954770 G -> T LOC_Os04g07450.1 downstream_gene_variant ; 2039.0bp to feature; MODIFIER silent_mutation Average:48.278; most accessible tissue: Zhenshan97 young leaf, score: 76.099 N N N N
vg0403954770 G -> T LOC_Os04g07460.1 downstream_gene_variant ; 4473.0bp to feature; MODIFIER silent_mutation Average:48.278; most accessible tissue: Zhenshan97 young leaf, score: 76.099 N N N N
vg0403954770 G -> T LOC_Os04g07440-LOC_Os04g07450 intergenic_region ; MODIFIER silent_mutation Average:48.278; most accessible tissue: Zhenshan97 young leaf, score: 76.099 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0403954770 NA 1.50E-06 mr1037 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403954770 NA 4.53E-09 mr1068 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403954770 NA 9.23E-08 mr1094 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403954770 NA 3.80E-07 mr1096 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403954770 NA 6.11E-07 mr1111 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403954770 NA 2.03E-08 mr1112 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403954770 NA 1.32E-07 mr1133 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403954770 NA 1.67E-08 mr1144 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403954770 NA 3.15E-07 mr1155 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403954770 NA 6.65E-10 mr1213 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403954770 NA 9.96E-07 mr1237 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403954770 NA 1.41E-07 mr1244 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403954770 NA 1.20E-06 mr1561 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403954770 NA 1.68E-06 mr1796 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403954770 NA 3.34E-08 mr1798 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403954770 NA 1.06E-06 mr1094_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403954770 NA 6.90E-07 mr1096_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403954770 NA 2.46E-07 mr1111_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403954770 NA 2.04E-06 mr1121_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403954770 NA 1.08E-06 mr1133_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403954770 NA 4.60E-07 mr1144_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403954770 NA 1.06E-08 mr1155_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403954770 NA 4.21E-07 mr1244_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403954770 NA 6.32E-06 mr1561_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403954770 5.59E-06 NA mr1798_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403954770 6.59E-06 3.51E-17 mr1798_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403954770 NA 5.10E-06 mr1971_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251