Search for Variation information by Variation ID:
Detailed information for vg0403728354:
| Variant ID: vg0403728354 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 3728354 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
Flanking Sequence (100 bp) in Reference Genome:
AACTGGAAAAGATCCTGATCCAGCCGCGACAGAAGCAAACGTATCCAAGGATCCTGAGACGACTGCCGAAAGCCAGCCGACTGCCGAAAGCCAGCCGACT[G/A]
GCGCCCATGCTTCGGGCGACAAGGCCAACCCGAGTGACCAGCCGCCGACTGGAAACCAGTCGGTAACAACTGAAGCAGCAACAACCCAAGAGCCCCCGAC
Reverse complement sequence
GTCGGGGGCTCTTGGGTTGTTGCTGCTTCAGTTGTTACCGACTGGTTTCCAGTCGGCGGCTGGTCACTCGGGTTGGCCTTGTCGCCCGAAGCATGGGCGC[C/T]
AGTCGGCTGGCTTTCGGCAGTCGGCTGGCTTTCGGCAGTCGTCTCAGGATCCTTGGATACGTTTGCTTCTGTCGCGGCTGGATCAGGATCTTTTCCAGTT
Allele Frequencies:
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 67.50% | 15.40% | 12.10% | 4.97% | NA |
| All Indica | 2759 | 45.70% | 26.10% | 19.83% | 8.30% | NA |
| All Japonica | 1512 | 98.40% | 0.20% | 1.32% | 0.07% | NA |
| Aus | 269 | 99.60% | 0.00% | 0.00% | 0.37% | NA |
| Indica I | 595 | 34.60% | 30.90% | 23.70% | 10.76% | NA |
| Indica II | 465 | 55.70% | 16.80% | 21.29% | 6.24% | NA |
| Indica III | 913 | 40.10% | 34.10% | 15.77% | 10.08% | NA |
| Indica Intermediate | 786 | 54.80% | 18.80% | 20.74% | 5.60% | NA |
| Temperate Japonica | 767 | 97.70% | 0.30% | 2.09% | 0.00% | NA |
| Tropical Japonica | 504 | 99.40% | 0.00% | 0.60% | 0.00% | NA |
| Japonica Intermediate | 241 | 98.80% | 0.40% | 0.41% | 0.41% | NA |
| VI/Aromatic | 96 | 96.90% | 1.00% | 1.04% | 1.04% | NA |
| Intermediate | 90 | 88.90% | 3.30% | 4.44% | 3.33% | NA |
Allele Effect:
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0403728354 | G -> DEL | LOC_Os04g07030.1 | N | frameshift_variant | Average:43.267; most accessible tissue: Minghui63 panicle, score: 59.629 | N | N | N | N |
| vg0403728354 | G -> A | LOC_Os04g07030.1 | missense_variant ; p.Gly432Ser; MODERATE | nonsynonymous_codon ; G432S | Average:43.267; most accessible tissue: Minghui63 panicle, score: 59.629 | benign  |
0.642 |
TOLERATED | 0.16 |
Putative Genotype-Phenotype Associations:
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0403728354 | NA | 8.03E-09 | mr1547 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0403728354 | NA | 9.92E-08 | mr1547 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0403728354 | NA | 6.15E-15 | mr1709 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0403728354 | NA | 1.32E-12 | mr1709 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0403728354 | NA | 1.91E-08 | mr1547_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0403728354 | NA | 1.70E-07 | mr1547_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0403728354 | 6.93E-13 | 3.10E-31 | mr1709_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0403728354 | 3.22E-09 | 6.69E-22 | mr1709_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |