| Variant ID: vg0403656258 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 3656258 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
CTGCTCTCCCGATCGCCGGTGCACGCCGGCGAGCGGGATGGAGTAGTCTACGAGCGACGGCGCAGTACAGAGTAGGAGGCAAACCCTAGATAGGTCGCCT[G/A]
ATCAGGGCGCCCGCGTAAACTGAACCGGATAAGTTGCGCGTAACCTATCCGGACTCCACGCCGTTTTCATGCACCGGATTTTTCGAAGTATTTCCAAAAC
GTTTTGGAAATACTTCGAAAAATCCGGTGCATGAAAACGGCGTGGAGTCCGGATAGGTTACGCGCAACTTATCCGGTTCAGTTTACGCGGGCGCCCTGAT[C/T]
AGGCGACCTATCTAGGGTTTGCCTCCTACTCTGTACTGCGCCGTCGCTCGTAGACTACTCCATCCCGCTCGCCGGCGTGCACCGGCGATCGGGAGAGCAG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 74.10% | 12.90% | 0.93% | 11.98% | NA |
| All Indica | 2759 | 81.40% | 11.70% | 0.69% | 6.20% | NA |
| All Japonica | 1512 | 62.30% | 18.10% | 0.99% | 18.65% | NA |
| Aus | 269 | 54.60% | 1.50% | 3.72% | 40.15% | NA |
| Indica I | 595 | 92.90% | 5.40% | 0.17% | 1.51% | NA |
| Indica II | 465 | 88.20% | 0.40% | 1.08% | 10.32% | NA |
| Indica III | 913 | 76.50% | 17.40% | 0.33% | 5.81% | NA |
| Indica Intermediate | 786 | 74.30% | 16.70% | 1.27% | 7.76% | NA |
| Temperate Japonica | 767 | 54.60% | 12.90% | 1.43% | 31.03% | NA |
| Tropical Japonica | 504 | 74.20% | 22.80% | 0.20% | 2.78% | NA |
| Japonica Intermediate | 241 | 61.80% | 24.50% | 1.24% | 12.45% | NA |
| VI/Aromatic | 96 | 99.00% | 0.00% | 0.00% | 1.04% | NA |
| Intermediate | 90 | 83.30% | 12.20% | 0.00% | 4.44% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0403656258 | G -> DEL | N | N | silent_mutation | Average:36.574; most accessible tissue: Zhenshan97 panicle, score: 87.764 | N | N | N | N |
| vg0403656258 | G -> A | LOC_Os04g06920.1 | intron_variant ; MODIFIER | silent_mutation | Average:36.574; most accessible tissue: Zhenshan97 panicle, score: 87.764 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0403656258 | NA | 5.99E-08 | mr1037 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0403656258 | NA | 1.68E-08 | mr1458 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0403656258 | NA | 3.21E-10 | mr1798 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0403656258 | NA | 7.53E-07 | mr1037_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0403656258 | NA | 3.04E-07 | mr1458_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0403656258 | 2.49E-06 | 4.08E-15 | mr1798_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |