\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0403315819:

Variant ID: vg0403315819 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 3315819
Reference Allele: AAlternative Allele: T
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ATTCCCGCTTGTGGCAAGCGCTGTATGTCTTCCAGGGTTTCCCACGAACCGGTCCTTAATTGCCATGGGTGCGACCAGCAAAACCATGCACCCACAGCCC[A/T]
CCATTCAGTCGAGTTTTAGTTGGATAATTACGACCATGAAACATGGCCGGATGTCTCGAGCCGCAGCTCATCATGATACTAACAGGTCTAATACTGCAAT

Reverse complement sequence

ATTGCAGTATTAGACCTGTTAGTATCATGATGAGCTGCGGCTCGAGACATCCGGCCATGTTTCATGGTCGTAATTATCCAACTAAAACTCGACTGAATGG[T/A]
GGGCTGTGGGTGCATGGTTTTGCTGGTCGCACCCATGGCAATTAAGGACCGGTTCGTGGGAAACCCTGGAAGACATACAGCGCTTGCCACAAGCGGGAAT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 88.30% 2.70% 4.76% 4.25% NA
All Indica  2759 98.50% 0.10% 1.01% 0.33% NA
All Japonica  1512 67.20% 8.20% 12.37% 12.24% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 95.80% 0.00% 3.03% 1.18% NA
Indica II  465 99.10% 0.20% 0.22% 0.43% NA
Indica III  913 99.70% 0.10% 0.22% 0.00% NA
Indica Intermediate  786 98.90% 0.30% 0.89% 0.00% NA
Temperate Japonica  767 92.20% 1.80% 3.78% 2.22% NA
Tropical Japonica  504 36.50% 14.90% 26.39% 22.22% NA
Japonica Intermediate  241 51.90% 14.50% 10.37% 23.24% NA
VI/Aromatic  96 91.70% 0.00% 6.25% 2.08% NA
Intermediate  90 88.90% 1.10% 4.44% 5.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0403315819 A -> DEL LOC_Os04g06360.1 N frameshift_variant Average:40.04; most accessible tissue: Minghui63 young leaf, score: 75.937 N N N N
vg0403315819 A -> T LOC_Os04g06360.1 missense_variant ; p.Thr198Ser; MODERATE nonsynonymous_codon ; T198S Average:40.04; most accessible tissue: Minghui63 young leaf, score: 75.937 unknown unknown DELETERIOUS 0.04

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0403315819 2.49E-07 2.49E-07 mr1020_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403315819 1.66E-06 1.66E-06 mr1153_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403315819 9.81E-07 7.73E-08 mr1228_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403315819 2.73E-07 3.58E-08 mr1232_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403315819 1.21E-06 1.21E-06 mr1262_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403315819 1.57E-06 1.57E-06 mr1266_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403315819 5.85E-06 NA mr1291_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403315819 NA 1.19E-07 mr1308_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403315819 1.54E-08 2.04E-10 mr1422_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403315819 1.99E-06 1.99E-06 mr1424_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403315819 5.70E-06 5.70E-06 mr1516_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403315819 6.01E-06 2.00E-07 mr1557_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403315819 NA 6.85E-06 mr1575_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403315819 NA 2.80E-06 mr1583_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403315819 NA 9.15E-06 mr1600_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403315819 6.48E-07 4.69E-09 mr1606_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403315819 2.17E-08 2.17E-08 mr1610_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403315819 NA 1.82E-06 mr1653_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403315819 8.13E-06 8.13E-06 mr1727_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403315819 1.52E-06 NA mr1800_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403315819 NA 7.93E-06 mr1819_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403315819 NA 9.09E-06 mr1853_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403315819 NA 2.63E-06 mr1860_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403315819 NA 2.14E-06 mr1873_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403315819 3.68E-07 2.81E-08 mr1884_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403315819 8.06E-06 2.96E-08 mr1905_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403315819 NA 2.45E-09 mr1916_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403315819 2.89E-06 1.21E-09 mr1942_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403315819 3.83E-06 1.29E-07 mr1944_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403315819 6.80E-06 6.81E-06 mr1984_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251