Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0403315819:

Variant ID: vg0403315819 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 3315819
Reference Allele: A	Alternative Allele: T
Primary Allele: A	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ATTCCCGCTTGTGGCAAGCGCTGTATGTCTTCCAGGGTTTCCCACGAACCGGTCCTTAATTGCCATGGGTGCGACCAGCAAAACCATGCACCCACAGCCC[A/T]
CCATTCAGTCGAGTTTTAGTTGGATAATTACGACCATGAAACATGGCCGGATGTCTCGAGCCGCAGCTCATCATGATACTAACAGGTCTAATACTGCAAT

Reverse complement sequence

ATTGCAGTATTAGACCTGTTAGTATCATGATGAGCTGCGGCTCGAGACATCCGGCCATGTTTCATGGTCGTAATTATCCAACTAAAACTCGACTGAATGG[T/A]
GGGCTGTGGGTGCATGGTTTTGCTGGTCGCACCCATGGCAATTAAGGACCGGTTCGTGGGAAACCCTGGAAGACATACAGCGCTTGCCACAAGCGGGAAT

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	88.30%	2.70%	4.76%	4.25%	NA
All Indica	2759	98.50%	0.10%	1.01%	0.33%	NA
All Japonica	1512	67.20%	8.20%	12.37%	12.24%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	95.80%	0.00%	3.03%	1.18%	NA
Indica II	465	99.10%	0.20%	0.22%	0.43%	NA
Indica III	913	99.70%	0.10%	0.22%	0.00%	NA
Indica Intermediate	786	98.90%	0.30%	0.89%	0.00%	NA
Temperate Japonica	767	92.20%	1.80%	3.78%	2.22%	NA
Tropical Japonica	504	36.50%	14.90%	26.39%	22.22%	NA
Japonica Intermediate	241	51.90%	14.50%	10.37%	23.24%	NA
VI/Aromatic	96	91.70%	0.00%	6.25%	2.08%	NA
Intermediate	90	88.90%	1.10%	4.44%	5.56%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0403315819	A -> DEL	LOC_Os04g06360.1	N	frameshift_variant	Average:40.04; most accessible tissue: Minghui63 young leaf, score: 75.937	N	N	N	N
vg0403315819	A -> T	LOC_Os04g06360.1	missense_variant ; p.Thr198Ser; MODERATE	nonsynonymous_codon ; T198S	Average:40.04; most accessible tissue: Minghui63 young leaf, score: 75.937	unknown	unknown	DELETERIOUS	0.04

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0403315819	2.49E-07	2.49E-07	mr1020_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403315819	1.66E-06	1.66E-06	mr1153_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403315819	9.81E-07	7.73E-08	mr1228_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403315819	2.73E-07	3.58E-08	mr1232_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403315819	1.21E-06	1.21E-06	mr1262_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403315819	1.57E-06	1.57E-06	mr1266_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403315819	5.85E-06	NA	mr1291_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403315819	NA	1.19E-07	mr1308_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403315819	1.54E-08	2.04E-10	mr1422_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403315819	1.99E-06	1.99E-06	mr1424_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403315819	5.70E-06	5.70E-06	mr1516_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403315819	6.01E-06	2.00E-07	mr1557_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403315819	NA	6.85E-06	mr1575_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403315819	NA	2.80E-06	mr1583_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403315819	NA	9.15E-06	mr1600_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403315819	6.48E-07	4.69E-09	mr1606_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403315819	2.17E-08	2.17E-08	mr1610_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403315819	NA	1.82E-06	mr1653_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403315819	8.13E-06	8.13E-06	mr1727_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403315819	1.52E-06	NA	mr1800_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403315819	NA	7.93E-06	mr1819_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403315819	NA	9.09E-06	mr1853_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403315819	NA	2.63E-06	mr1860_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403315819	NA	2.14E-06	mr1873_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403315819	3.68E-07	2.81E-08	mr1884_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403315819	8.06E-06	2.96E-08	mr1905_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403315819	NA	2.45E-09	mr1916_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403315819	2.89E-06	1.21E-09	mr1942_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403315819	3.83E-06	1.29E-07	mr1944_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403315819	6.80E-06	6.81E-06	mr1984_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251