\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0403206782:

Variant ID: vg0403206782 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 3206782
Reference Allele: AAlternative Allele: T
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.98, T: 0.02, others allele: 0.00, population size: 43. )

Flanking Sequence (100 bp) in Reference Genome:


CTCTGGCAACCTGGACTAAGGGGGACGGGGACCAAACTGCTGGTGCTGCTGTTCGGCGTGCTGCATCATCCTCTGGTGCATCTGCTGGTGCTACTGCTGC[A/T]
TCTGCTGCATCATGGCTGCCATCATCTGAGTCTGATGTGCCATAACTTGGGCCAGTGTCGGATTTTCGGGAAGTGGTGGCGGACCATTGCCGGAATCACT

Reverse complement sequence

AGTGATTCCGGCAATGGTCCGCCACCACTTCCCGAAAATCCGACACTGGCCCAAGTTATGGCACATCAGACTCAGATGATGGCAGCCATGATGCAGCAGA[T/A]
GCAGCAGTAGCACCAGCAGATGCACCAGAGGATGATGCAGCACGCCGAACAGCAGCACCAGCAGTTTGGTCCCCGTCCCCCTTAGTCCAGGTTGCCAGAG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 70.20% 13.80% 8.74% 7.19% NA
All Indica  2759 60.90% 23.00% 9.06% 7.03% NA
All Japonica  1512 80.50% 0.70% 9.72% 9.06% NA
Aus  269 99.30% 0.00% 0.37% 0.37% NA
Indica I  595 45.50% 45.90% 5.04% 3.53% NA
Indica II  465 63.70% 12.30% 14.41% 9.68% NA
Indica III  913 69.00% 14.00% 9.75% 7.23% NA
Indica Intermediate  786 61.50% 22.50% 8.14% 7.89% NA
Temperate Japonica  767 88.00% 0.70% 7.95% 3.39% NA
Tropical Japonica  504 73.40% 0.40% 12.10% 14.09% NA
Japonica Intermediate  241 71.40% 1.70% 10.37% 16.60% NA
VI/Aromatic  96 91.70% 0.00% 6.25% 2.08% NA
Intermediate  90 75.60% 7.80% 10.00% 6.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0403206782 A -> DEL N N silent_mutation Average:24.298; most accessible tissue: Callus, score: 39.001 N N N N
vg0403206782 A -> T LOC_Os04g06144.1 upstream_gene_variant ; 701.0bp to feature; MODIFIER silent_mutation Average:24.298; most accessible tissue: Callus, score: 39.001 N N N N
vg0403206782 A -> T LOC_Os04g06160.1 downstream_gene_variant ; 430.0bp to feature; MODIFIER silent_mutation Average:24.298; most accessible tissue: Callus, score: 39.001 N N N N
vg0403206782 A -> T LOC_Os04g06144-LOC_Os04g06160 intergenic_region ; MODIFIER silent_mutation Average:24.298; most accessible tissue: Callus, score: 39.001 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0403206782 NA 4.53E-35 mr1026 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403206782 NA 6.06E-19 mr1026 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403206782 NA 7.96E-08 mr1113 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403206782 NA 2.64E-08 mr1114 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403206782 NA 4.83E-08 mr1116 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403206782 NA 3.84E-18 mr1118 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403206782 1.02E-06 4.77E-20 mr1118 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403206782 NA 1.42E-07 mr1120 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403206782 NA 1.47E-16 mr1161 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403206782 NA 2.20E-06 mr1247 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403206782 NA 8.48E-23 mr1495 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403206782 NA 1.47E-23 mr1495 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403206782 NA 9.26E-10 mr1496 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403206782 NA 3.05E-06 mr1789 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403206782 NA 2.02E-10 mr1794 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403206782 7.65E-06 1.12E-07 mr1113_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403206782 2.64E-06 4.05E-08 mr1114_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403206782 NA 3.18E-06 mr1117_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403206782 NA 3.44E-20 mr1118_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403206782 NA 2.66E-23 mr1118_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403206782 7.05E-07 1.25E-10 mr1120_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403206782 NA 1.54E-34 mr1161_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403206782 NA 5.43E-19 mr1161_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403206782 NA 7.31E-08 mr1212_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403206782 NA 1.48E-07 mr1233_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403206782 1.06E-06 7.87E-09 mr1247_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403206782 3.64E-06 NA mr1258_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403206782 3.69E-07 7.65E-06 mr1258_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403206782 3.60E-06 1.17E-29 mr1495_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403206782 7.74E-06 5.90E-27 mr1495_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403206782 NA 1.08E-07 mr1496_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403206782 NA 5.21E-14 mr1794_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403206782 NA 6.38E-07 mr1936_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251