\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0403140954:

Variant ID: vg0403140954 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 3140954
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.62, A: 0.38, others allele: 0.00, population size: 45. )

Flanking Sequence (100 bp) in Reference Genome:


ATACTTGACAATGCCCAAGATGAACATGGCTACAGAGACCCAGCTGAACATGGTGCCAGTGCCACTTCTGGCGACAATATTCTGGAACATGGCATATACT[A/G]
CTCCGATCACCTGAAATAACATTTCCAACATCTGGCGAGTGGAAAGAACGTTGTCCTCCAGGGAGTAGGCGGTGATGTTATCCGGACCACCGGCATGTAG

Reverse complement sequence

CTACATGCCGGTGGTCCGGATAACATCACCGCCTACTCCCTGGAGGACAACGTTCTTTCCACTCGCCAGATGTTGGAAATGTTATTTCAGGTGATCGGAG[T/C]
AGTATATGCCATGTTCCAGAATATTGTCGCCAGAAGTGGCACTGGCACCATGTTCAGCTGGGTCTCTGTAGCCATGTTCATCTTGGGCATTGTCAAGTAT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 27.00% 18.10% 2.88% 52.07% NA
All Indica  2759 31.20% 5.40% 2.39% 61.00% NA
All Japonica  1512 11.80% 43.80% 4.37% 40.08% NA
Aus  269 56.10% 9.30% 0.74% 33.83% NA
Indica I  595 4.70% 3.70% 1.51% 90.08% NA
Indica II  465 29.00% 6.90% 1.08% 63.01% NA
Indica III  913 46.80% 2.60% 3.61% 46.99% NA
Indica Intermediate  786 34.50% 9.00% 2.42% 54.07% NA
Temperate Japonica  767 6.40% 68.30% 6.00% 19.30% NA
Tropical Japonica  504 12.70% 16.70% 3.17% 67.46% NA
Japonica Intermediate  241 27.00% 22.40% 1.66% 48.96% NA
VI/Aromatic  96 51.00% 4.20% 0.00% 44.79% NA
Intermediate  90 40.00% 15.60% 2.22% 42.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0403140954 A -> DEL LOC_Os04g06050.1 N frameshift_variant Average:14.574; most accessible tissue: Callus, score: 82.516 N N N N
vg0403140954 A -> G LOC_Os04g06050.1 missense_variant ; p.Val122Ala; MODERATE nonsynonymous_codon ; V122A Average:14.574; most accessible tissue: Callus, score: 82.516 benign -1.453 TOLERATED 1.00

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0403140954 3.50E-07 3.50E-07 mr1066_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403140954 2.71E-06 2.71E-06 mr1192_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403140954 6.59E-06 6.59E-06 mr1329_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403140954 2.54E-06 2.54E-06 mr1337_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403140954 2.40E-07 1.10E-07 mr1445_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403140954 7.86E-06 NA mr1637_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403140954 NA 2.38E-06 mr1648_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403140954 NA 4.70E-06 mr1669_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403140954 3.92E-06 3.93E-06 mr1674_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403140954 4.68E-06 4.68E-06 mr1697_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403140954 NA 5.77E-06 mr1705_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403140954 6.93E-06 NA mr1750_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403140954 5.70E-06 5.70E-06 mr1822_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403140954 6.07E-07 6.07E-07 mr1982_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251