Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0403140954:

Variant ID: vg0403140954 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 3140954
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.62, A: 0.38, others allele: 0.00, population size: 45. )

Flanking Sequence (100 bp) in Reference Genome:

ATACTTGACAATGCCCAAGATGAACATGGCTACAGAGACCCAGCTGAACATGGTGCCAGTGCCACTTCTGGCGACAATATTCTGGAACATGGCATATACT[A/G]
CTCCGATCACCTGAAATAACATTTCCAACATCTGGCGAGTGGAAAGAACGTTGTCCTCCAGGGAGTAGGCGGTGATGTTATCCGGACCACCGGCATGTAG

Reverse complement sequence

CTACATGCCGGTGGTCCGGATAACATCACCGCCTACTCCCTGGAGGACAACGTTCTTTCCACTCGCCAGATGTTGGAAATGTTATTTCAGGTGATCGGAG[T/C]
AGTATATGCCATGTTCCAGAATATTGTCGCCAGAAGTGGCACTGGCACCATGTTCAGCTGGGTCTCTGTAGCCATGTTCATCTTGGGCATTGTCAAGTAT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	27.00%	18.10%	2.88%	52.07%	NA
All Indica	2759	31.20%	5.40%	2.39%	61.00%	NA
All Japonica	1512	11.80%	43.80%	4.37%	40.08%	NA
Aus	269	56.10%	9.30%	0.74%	33.83%	NA
Indica I	595	4.70%	3.70%	1.51%	90.08%	NA
Indica II	465	29.00%	6.90%	1.08%	63.01%	NA
Indica III	913	46.80%	2.60%	3.61%	46.99%	NA
Indica Intermediate	786	34.50%	9.00%	2.42%	54.07%	NA
Temperate Japonica	767	6.40%	68.30%	6.00%	19.30%	NA
Tropical Japonica	504	12.70%	16.70%	3.17%	67.46%	NA
Japonica Intermediate	241	27.00%	22.40%	1.66%	48.96%	NA
VI/Aromatic	96	51.00%	4.20%	0.00%	44.79%	NA
Intermediate	90	40.00%	15.60%	2.22%	42.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0403140954	A -> DEL	LOC_Os04g06050.1	N	frameshift_variant	Average:14.574; most accessible tissue: Callus, score: 82.516	N	N	N	N
vg0403140954	A -> G	LOC_Os04g06050.1	missense_variant ; p.Val122Ala; MODERATE	nonsynonymous_codon ; V122A	Average:14.574; most accessible tissue: Callus, score: 82.516	benign	-1.453	TOLERATED	1.00

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0403140954	3.50E-07	3.50E-07	mr1066_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403140954	2.71E-06	2.71E-06	mr1192_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403140954	6.59E-06	6.59E-06	mr1329_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403140954	2.54E-06	2.54E-06	mr1337_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403140954	2.40E-07	1.10E-07	mr1445_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403140954	7.86E-06	NA	mr1637_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403140954	NA	2.38E-06	mr1648_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403140954	NA	4.70E-06	mr1669_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403140954	3.92E-06	3.93E-06	mr1674_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403140954	4.68E-06	4.68E-06	mr1697_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403140954	NA	5.77E-06	mr1705_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403140954	6.93E-06	NA	mr1750_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403140954	5.70E-06	5.70E-06	mr1822_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403140954	6.07E-07	6.07E-07	mr1982_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251