\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0403054381:

Variant ID: vg0403054381 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 3054381
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CTGGATACTATCGAAGGTTCATTGAAGGATTCTCTAAGATAGCTCGACCAATGACACAACTAGTCAAGAAGGAAAAGAAGTTTGTGTGGTCAGAACAGTG[C/T]
CAGGAAAGCTTTGAGCAGCTCAAAGAAAAGCTGACCTCGGCGCCTATTTTAGTTCTTCCCGACATCAGGAAAGACTTTGTTATATATTGTGATGCATCAA

Reverse complement sequence

TTGATGCATCACAATATATAACAAAGTCTTTCCTGATGTCGGGAAGAACTAAAATAGGCGCCGAGGTCAGCTTTTCTTTGAGCTGCTCAAAGCTTTCCTG[G/A]
CACTGTTCTGACCACACAAACTTCTTTTCCTTCTTGACTAGTTGTGTCATTGGTCGAGCTATCTTAGAGAATCCTTCAATGAACCTTCGATAGTATCCAG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 43.10% 19.60% 24.59% 12.80% NA
All Indica  2759 65.80% 6.80% 22.54% 4.89% NA
All Japonica  1512 8.10% 37.90% 27.98% 25.99% NA
Aus  269 17.80% 53.90% 16.36% 11.90% NA
Indica I  595 34.50% 7.60% 50.42% 7.56% NA
Indica II  465 71.00% 11.60% 14.19% 3.23% NA
Indica III  913 85.10% 1.50% 9.86% 3.50% NA
Indica Intermediate  786 64.00% 9.40% 21.12% 5.47% NA
Temperate Japonica  767 6.50% 64.80% 11.99% 16.69% NA
Tropical Japonica  504 8.70% 6.20% 44.44% 40.67% NA
Japonica Intermediate  241 12.00% 18.70% 44.40% 24.90% NA
VI/Aromatic  96 11.50% 3.10% 47.92% 37.50% NA
Intermediate  90 42.20% 17.80% 30.00% 10.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0403054381 C -> DEL LOC_Os04g05900.1 N frameshift_variant Average:7.596; most accessible tissue: Callus, score: 13.956 N N N N
vg0403054381 C -> T LOC_Os04g05900.1 synonymous_variant ; p.Cys674Cys; LOW synonymous_codon Average:7.596; most accessible tissue: Callus, score: 13.956 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0403054381 NA 1.00E-06 mr1026 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403054381 NA 4.92E-06 mr1069 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403054381 NA 3.30E-09 mr1137 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403054381 NA 2.16E-07 mr1164 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403054381 NA 1.46E-07 mr1229 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403054381 NA 7.71E-06 mr1380 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403054381 3.62E-06 3.61E-06 mr1494 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403054381 NA 5.12E-06 mr1521 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403054381 NA 4.07E-06 mr1596 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403054381 NA 2.95E-08 mr1617 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403054381 NA 2.77E-08 mr1627 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403054381 NA 1.06E-08 mr1763 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403054381 NA 9.91E-07 mr1880 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403054381 NA 3.40E-10 mr1137_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403054381 NA 2.94E-07 mr1521_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403054381 NA 1.98E-07 mr1617_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403054381 NA 5.72E-06 mr1627_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251