Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0402663053:

Variant ID: vg0402663053 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 2663053
Reference Allele: C	Alternative Allele: A
Primary Allele: C	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CGACGGGGTTGCTCAAGGCAGAAATGTACGACTTGTTCTTGAGGTTAGTTCGCGACGAGATCCAGCAGCAAATCATTATCTGGCACATCGCGACGGACAT[C/A]
TACCTCCGCACCTCCGACAAGGCAGAGACCACCGAGTATGTTGAAGCAATCAATCTTATTTCCAACTACATGATGTTCCTAGTTCTGGAACGTCCCTACA

Reverse complement sequence

TGTAGGGACGTTCCAGAACTAGGAACATCATGTAGTTGGAAATAAGATTGATTGCTTCAACATACTCGGTGGTCTCTGCCTTGTCGGAGGTGCGGAGGTA[G/T]
ATGTCCGTCGCGATGTGCCAGATAATGATTTGCTGCTGGATCTCGTCGCGAACTAACCTCAAGAACAAGTCGTACATTTCTGCCTTGAGCAACCCCGTCG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	75.80%	4.10%	3.55%	16.53%	NA
All Indica	2759	75.10%	5.50%	2.54%	16.93%	NA
All Japonica	1512	80.60%	0.30%	4.23%	14.81%	NA
Aus	269	45.40%	13.80%	11.90%	29.00%	NA
Indica I	595	97.60%	0.20%	0.84%	1.34%	NA
Indica II	465	83.00%	0.20%	3.01%	13.76%	NA
Indica III	913	55.40%	12.20%	2.30%	30.12%	NA
Indica Intermediate	786	76.10%	4.80%	3.82%	15.27%	NA
Temperate Japonica	767	92.70%	0.00%	1.83%	5.48%	NA
Tropical Japonica	504	60.90%	1.00%	8.73%	29.37%	NA
Japonica Intermediate	241	83.40%	0.00%	2.49%	14.11%	NA
VI/Aromatic	96	96.90%	1.00%	1.04%	1.04%	NA
Intermediate	90	84.40%	2.20%	1.11%	12.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0402663053	C -> DEL	N	N	silent_mutation	Average:36.988; most accessible tissue: Zhenshan97 flag leaf, score: 79.481	N	N	N	N
vg0402663053	C -> A	LOC_Os04g05340.1	upstream_gene_variant ; 3135.0bp to feature; MODIFIER	silent_mutation	Average:36.988; most accessible tissue: Zhenshan97 flag leaf, score: 79.481	N	N	N	N
vg0402663053	C -> A	LOC_Os04g05360.1	downstream_gene_variant ; 4508.0bp to feature; MODIFIER	silent_mutation	Average:36.988; most accessible tissue: Zhenshan97 flag leaf, score: 79.481	N	N	N	N
vg0402663053	C -> A	LOC_Os04g05340-LOC_Os04g05360	intergenic_region ; MODIFIER	silent_mutation	Average:36.988; most accessible tissue: Zhenshan97 flag leaf, score: 79.481	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0402663053	NA	6.49E-06	mr1042	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402663053	NA	3.48E-07	mr1126	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402663053	NA	2.67E-06	mr1181	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402663053	NA	2.25E-06	mr1479	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402663053	NA	4.98E-06	mr1502	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402663053	NA	1.46E-06	mr1523	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402663053	NA	2.45E-06	mr1561	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402663053	NA	3.04E-06	mr1590	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402663053	1.62E-07	1.62E-07	mr1722	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402663053	NA	2.38E-07	mr1798	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402663053	NA	9.77E-08	mr1380_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402663053	4.67E-06	6.90E-09	mr1561_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402663053	NA	1.16E-07	mr1653_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402663053	NA	4.91E-09	mr1798_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402663053	NA	9.44E-08	mr1908_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402663053	NA	1.91E-08	mr1996_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251