\
| Variant ID: vg0402663053 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 2663053 |
| Reference Allele: C | Alternative Allele: A |
| Primary Allele: C | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
CGACGGGGTTGCTCAAGGCAGAAATGTACGACTTGTTCTTGAGGTTAGTTCGCGACGAGATCCAGCAGCAAATCATTATCTGGCACATCGCGACGGACAT[C/A]
TACCTCCGCACCTCCGACAAGGCAGAGACCACCGAGTATGTTGAAGCAATCAATCTTATTTCCAACTACATGATGTTCCTAGTTCTGGAACGTCCCTACA
TGTAGGGACGTTCCAGAACTAGGAACATCATGTAGTTGGAAATAAGATTGATTGCTTCAACATACTCGGTGGTCTCTGCCTTGTCGGAGGTGCGGAGGTA[G/T]
ATGTCCGTCGCGATGTGCCAGATAATGATTTGCTGCTGGATCTCGTCGCGAACTAACCTCAAGAACAAGTCGTACATTTCTGCCTTGAGCAACCCCGTCG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 75.80% | 4.10% | 3.55% | 16.53% | NA |
| All Indica | 2759 | 75.10% | 5.50% | 2.54% | 16.93% | NA |
| All Japonica | 1512 | 80.60% | 0.30% | 4.23% | 14.81% | NA |
| Aus | 269 | 45.40% | 13.80% | 11.90% | 29.00% | NA |
| Indica I | 595 | 97.60% | 0.20% | 0.84% | 1.34% | NA |
| Indica II | 465 | 83.00% | 0.20% | 3.01% | 13.76% | NA |
| Indica III | 913 | 55.40% | 12.20% | 2.30% | 30.12% | NA |
| Indica Intermediate | 786 | 76.10% | 4.80% | 3.82% | 15.27% | NA |
| Temperate Japonica | 767 | 92.70% | 0.00% | 1.83% | 5.48% | NA |
| Tropical Japonica | 504 | 60.90% | 1.00% | 8.73% | 29.37% | NA |
| Japonica Intermediate | 241 | 83.40% | 0.00% | 2.49% | 14.11% | NA |
| VI/Aromatic | 96 | 96.90% | 1.00% | 1.04% | 1.04% | NA |
| Intermediate | 90 | 84.40% | 2.20% | 1.11% | 12.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0402663053 | C -> DEL | N | N | silent_mutation | Average:36.988; most accessible tissue: Zhenshan97 flag leaf, score: 79.481 | N | N | N | N |
| vg0402663053 | C -> A | LOC_Os04g05340.1 | upstream_gene_variant ; 3135.0bp to feature; MODIFIER | silent_mutation | Average:36.988; most accessible tissue: Zhenshan97 flag leaf, score: 79.481 | N | N | N | N |
| vg0402663053 | C -> A | LOC_Os04g05360.1 | downstream_gene_variant ; 4508.0bp to feature; MODIFIER | silent_mutation | Average:36.988; most accessible tissue: Zhenshan97 flag leaf, score: 79.481 | N | N | N | N |
| vg0402663053 | C -> A | LOC_Os04g05340-LOC_Os04g05360 | intergenic_region ; MODIFIER | silent_mutation | Average:36.988; most accessible tissue: Zhenshan97 flag leaf, score: 79.481 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0402663053 | NA | 6.49E-06 | mr1042 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0402663053 | NA | 3.48E-07 | mr1126 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0402663053 | NA | 2.67E-06 | mr1181 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0402663053 | NA | 2.25E-06 | mr1479 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0402663053 | NA | 4.98E-06 | mr1502 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0402663053 | NA | 1.46E-06 | mr1523 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0402663053 | NA | 2.45E-06 | mr1561 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0402663053 | NA | 3.04E-06 | mr1590 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0402663053 | 1.62E-07 | 1.62E-07 | mr1722 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0402663053 | NA | 2.38E-07 | mr1798 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0402663053 | NA | 9.77E-08 | mr1380_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0402663053 | 4.67E-06 | 6.90E-09 | mr1561_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0402663053 | NA | 1.16E-07 | mr1653_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0402663053 | NA | 4.91E-09 | mr1798_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0402663053 | NA | 9.44E-08 | mr1908_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0402663053 | NA | 1.91E-08 | mr1996_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |