\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0402663053:

Variant ID: vg0402663053 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 2663053
Reference Allele: CAlternative Allele: A
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CGACGGGGTTGCTCAAGGCAGAAATGTACGACTTGTTCTTGAGGTTAGTTCGCGACGAGATCCAGCAGCAAATCATTATCTGGCACATCGCGACGGACAT[C/A]
TACCTCCGCACCTCCGACAAGGCAGAGACCACCGAGTATGTTGAAGCAATCAATCTTATTTCCAACTACATGATGTTCCTAGTTCTGGAACGTCCCTACA

Reverse complement sequence

TGTAGGGACGTTCCAGAACTAGGAACATCATGTAGTTGGAAATAAGATTGATTGCTTCAACATACTCGGTGGTCTCTGCCTTGTCGGAGGTGCGGAGGTA[G/T]
ATGTCCGTCGCGATGTGCCAGATAATGATTTGCTGCTGGATCTCGTCGCGAACTAACCTCAAGAACAAGTCGTACATTTCTGCCTTGAGCAACCCCGTCG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 75.80% 4.10% 3.55% 16.53% NA
All Indica  2759 75.10% 5.50% 2.54% 16.93% NA
All Japonica  1512 80.60% 0.30% 4.23% 14.81% NA
Aus  269 45.40% 13.80% 11.90% 29.00% NA
Indica I  595 97.60% 0.20% 0.84% 1.34% NA
Indica II  465 83.00% 0.20% 3.01% 13.76% NA
Indica III  913 55.40% 12.20% 2.30% 30.12% NA
Indica Intermediate  786 76.10% 4.80% 3.82% 15.27% NA
Temperate Japonica  767 92.70% 0.00% 1.83% 5.48% NA
Tropical Japonica  504 60.90% 1.00% 8.73% 29.37% NA
Japonica Intermediate  241 83.40% 0.00% 2.49% 14.11% NA
VI/Aromatic  96 96.90% 1.00% 1.04% 1.04% NA
Intermediate  90 84.40% 2.20% 1.11% 12.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0402663053 C -> DEL N N silent_mutation Average:36.988; most accessible tissue: Zhenshan97 flag leaf, score: 79.481 N N N N
vg0402663053 C -> A LOC_Os04g05340.1 upstream_gene_variant ; 3135.0bp to feature; MODIFIER silent_mutation Average:36.988; most accessible tissue: Zhenshan97 flag leaf, score: 79.481 N N N N
vg0402663053 C -> A LOC_Os04g05360.1 downstream_gene_variant ; 4508.0bp to feature; MODIFIER silent_mutation Average:36.988; most accessible tissue: Zhenshan97 flag leaf, score: 79.481 N N N N
vg0402663053 C -> A LOC_Os04g05340-LOC_Os04g05360 intergenic_region ; MODIFIER silent_mutation Average:36.988; most accessible tissue: Zhenshan97 flag leaf, score: 79.481 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0402663053 NA 6.49E-06 mr1042 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402663053 NA 3.48E-07 mr1126 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402663053 NA 2.67E-06 mr1181 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402663053 NA 2.25E-06 mr1479 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402663053 NA 4.98E-06 mr1502 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402663053 NA 1.46E-06 mr1523 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402663053 NA 2.45E-06 mr1561 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402663053 NA 3.04E-06 mr1590 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402663053 1.62E-07 1.62E-07 mr1722 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402663053 NA 2.38E-07 mr1798 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402663053 NA 9.77E-08 mr1380_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402663053 4.67E-06 6.90E-09 mr1561_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402663053 NA 1.16E-07 mr1653_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402663053 NA 4.91E-09 mr1798_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402663053 NA 9.44E-08 mr1908_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402663053 NA 1.91E-08 mr1996_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251