\
| Variant ID: vg0402466598 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 2466598 |
| Reference Allele: G | Alternative Allele: T |
| Primary Allele: G | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
GGATGGTGAGTTGGGACCAAGGGGAAACGAACTATGGAGTTTGGAAACTTCACCTTCTCACACGTAAAATGAAATGATTCATTAATTAAACATTAATTAA[G/T]
GTAAATTTAAAAATAGATTAGTATAGTTTTTAAAGTAACTATTTTACTATTATTTAAAAAATATACCATTTAATAGTTTGTGAAACATGCAAGTGATGTG
CACATCACTTGCATGTTTCACAAACTATTAAATGGTATATTTTTTAAATAATAGTAAAATAGTTACTTTAAAAACTATACTAATCTATTTTTAAATTTAC[C/A]
TTAATTAATGTTTAATTAATGAATCATTTCATTTTACGTGTGAGAAGGTGAAGTTTCCAAACTCCATAGTTCGTTTCCCCTTGGTCCCAACTCACCATCC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 93.80% | 6.20% | 0.02% | 0.00% | NA |
| All Indica | 2759 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 81.20% | 18.80% | 0.07% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.40% | 0.60% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 70.70% | 29.20% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 95.60% | 4.40% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 84.20% | 15.80% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 98.90% | 1.10% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0402466598 | G -> T | LOC_Os04g05040-LOC_Os04g05050 | intergenic_region ; MODIFIER | silent_mutation | Average:56.521; most accessible tissue: Zhenshan97 panicle, score: 90.268 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0402466598 | NA | 1.11E-08 | mr1549 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0402466598 | NA | 2.91E-09 | mr1757 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0402466598 | 6.01E-06 | NA | mr1549_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0402466598 | NA | 1.59E-07 | mr1549_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0402466598 | NA | 2.94E-07 | mr1733_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0402466598 | 3.09E-08 | NA | mr1757_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0402466598 | NA | 2.11E-09 | mr1757_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |