\
| Variant ID: vg0402455204 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 2455204 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
TTCGTTGTATTAGGCTATATCTCATCTTTATCTATGTTTTTTTATGGACGGGAATATATCGTATAAAATGATTAACACTAAACTTAATATATTTGTAAAA[T/C]
GTTTTAGAAAAAGGATAAAGTGGAAGATCGGAAAAGGGACATTGGAACGCAGCTTTTAAGTCATTCGGATTTACTATGCGTTTGTTATAAGAAGAGGTTC
GAACCTCTTCTTATAACAAACGCATAGTAAATCCGAATGACTTAAAAGCTGCGTTCCAATGTCCCTTTTCCGATCTTCCACTTTATCCTTTTTCTAAAAC[A/G]
TTTTACAAATATATTAAGTTTAGTGTTAATCATTTTATACGATATATTCCCGTCCATAAAAAAACATAGATAAAGATGAGATATAGCCTAATACAACGAA
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 87.20% | 12.00% | 0.83% | 0.00% | NA |
| All Indica | 2759 | 87.40% | 12.50% | 0.04% | 0.00% | NA |
| All Japonica | 1512 | 85.00% | 13.80% | 1.26% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 98.20% | 1.80% | 0.00% | 0.00% | NA |
| Indica II | 465 | 98.10% | 1.90% | 0.00% | 0.00% | NA |
| Indica III | 913 | 75.10% | 24.90% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 87.30% | 12.60% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 97.70% | 2.10% | 0.26% | 0.00% | NA |
| Tropical Japonica | 504 | 69.00% | 27.80% | 3.17% | 0.00% | NA |
| Japonica Intermediate | 241 | 78.00% | 21.60% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 77.10% | 4.20% | 18.75% | 0.00% | NA |
| Intermediate | 90 | 90.00% | 8.90% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0402455204 | T -> C | LOC_Os04g05040.1 | upstream_gene_variant ; 4180.0bp to feature; MODIFIER | silent_mutation | Average:47.524; most accessible tissue: Callus, score: 94.211 | N | N | N | N |
| vg0402455204 | T -> C | LOC_Os04g05040-LOC_Os04g05050 | intergenic_region ; MODIFIER | silent_mutation | Average:47.524; most accessible tissue: Callus, score: 94.211 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0402455204 | NA | 1.30E-09 | Awn_length | Ind_All | YES | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0402455204 | NA | 5.80E-07 | mr1037 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0402455204 | 4.66E-08 | NA | mr1798 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0402455204 | NA | 1.27E-09 | mr1798 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0402455204 | 1.46E-19 | NA | mr1798_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0402455204 | 8.62E-10 | 2.05E-14 | mr1798_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0402455204 | 4.25E-11 | NA | mr1798_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |