\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0402387202:

Variant ID: vg0402387202 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 2387202
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 126. )

Flanking Sequence (100 bp) in Reference Genome:


GACTGGCAGCTTGTGGCCATAGTCGACAACAATCCAAGAAGAGAAGACCTGGTACATCCAGGAGCACATGATGTCAAAAGCAATAGAATCTTCATCTTCT[C/T]
GTTTGGGTTTAGTCTAGCCCTCATACTTGAAGGTTGGCTTTGATCTCTCCTTGATTGGGGTCAGCCGACACTTTATAAGATGTCGAGTGACTTGTTCCCC

Reverse complement sequence

GGGGAACAAGTCACTCGACATCTTATAAAGTGTCGGCTGACCCCAATCAAGGAGAGATCAAAGCCAACCTTCAAGTATGAGGGCTAGACTAAACCCAAAC[G/A]
AGAAGATGAAGATTCTATTGCTTTTGACATCATGTGCTCCTGGATGTACCAGGTCTTCTCTTCTTGGATTGTTGTCGACTATGGCCACAAGCTGCCAGTC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 90.40% 4.50% 4.02% 1.02% NA
All Indica  2759 84.50% 7.40% 6.42% 1.74% NA
All Japonica  1512 99.40% 0.20% 0.40% 0.00% NA
Aus  269 98.90% 1.10% 0.00% 0.00% NA
Indica I  595 57.10% 22.40% 20.34% 0.17% NA
Indica II  465 90.10% 3.70% 6.24% 0.00% NA
Indica III  913 95.80% 0.00% 0.44% 3.72% NA
Indica Intermediate  786 88.50% 6.90% 2.93% 1.65% NA
Temperate Japonica  767 99.70% 0.10% 0.13% 0.00% NA
Tropical Japonica  504 99.20% 0.00% 0.79% 0.00% NA
Japonica Intermediate  241 98.80% 0.80% 0.41% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 87.80% 4.40% 7.78% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0402387202 C -> DEL N N silent_mutation Average:40.679; most accessible tissue: Minghui63 young leaf, score: 66.656 N N N N
vg0402387202 C -> T LOC_Os04g04940.1 upstream_gene_variant ; 3037.0bp to feature; MODIFIER silent_mutation Average:40.679; most accessible tissue: Minghui63 young leaf, score: 66.656 N N N N
vg0402387202 C -> T LOC_Os04g04950.1 downstream_gene_variant ; 3076.0bp to feature; MODIFIER silent_mutation Average:40.679; most accessible tissue: Minghui63 young leaf, score: 66.656 N N N N
vg0402387202 C -> T LOC_Os04g04940-LOC_Os04g04950 intergenic_region ; MODIFIER silent_mutation Average:40.679; most accessible tissue: Minghui63 young leaf, score: 66.656 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0402387202 NA 4.39E-06 mr1182 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402387202 NA 5.58E-06 mr1274 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402387202 8.08E-06 NA mr1565 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402387202 3.77E-06 6.87E-09 mr1565 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251