\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0402290226:

Variant ID: vg0402290226 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 2290226
Reference Allele: GAlternative Allele: C,T
Primary Allele: GSecondary Allele: C

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.96, C: 0.04, others allele: 0.00, population size: 69. )

Flanking Sequence (100 bp) in Reference Genome:


CTCGGCCCTCAGCTCCCCTCTCCCTCAGCCCCTCAGCGACCGTGGGCATTCCGGGGGCAGCGACGGCAAGGTGCGGGGTCGGCGGACAACGGCGAGGCGT[G/C,T]
AGGTCGGTGATGGCGAGGCATGGGGTGGGCGACGGCGATGCGCGGGGGCGGCGGCATCCACCCTCGGCGCGGCTCCTCTCCCCTCCCTTCTAGATGTGGC

Reverse complement sequence

GCCACATCTAGAAGGGAGGGGAGAGGAGCCGCGCCGAGGGTGGATGCCGCCGCCCCCGCGCATCGCCGTCGCCCACCCCATGCCTCGCCATCACCGACCT[C/G,A]
ACGCCTCGCCGTTGTCCGCCGACCCCGCACCTTGCCGTCGCTGCCCCCGGAATGCCCACGGTCGCTGAGGGGCTGAGGGAGAGGGGAGCTGAGGGCCGAG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 52.50% 35.20% 0.83% 11.34% T: 0.15%
All Indica  2759 45.70% 52.10% 1.05% 0.91% T: 0.25%
All Japonica  1512 60.40% 11.90% 0.26% 27.45% NA
Aus  269 85.10% 1.10% 1.12% 12.64% NA
Indica I  595 44.90% 54.50% 0.50% 0.17% NA
Indica II  465 8.20% 90.80% 0.65% 0.43% NA
Indica III  913 66.50% 31.10% 1.10% 1.10% T: 0.22%
Indica Intermediate  786 44.40% 51.80% 1.65% 1.53% T: 0.64%
Temperate Japonica  767 75.50% 0.70% 0.26% 23.60% NA
Tropical Japonica  504 40.50% 32.10% 0.40% 26.98% NA
Japonica Intermediate  241 53.90% 5.40% 0.00% 40.66% NA
VI/Aromatic  96 43.80% 5.20% 2.08% 48.96% NA
Intermediate  90 41.10% 41.10% 1.11% 16.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0402290226 G -> C LOC_Os04g04770.1 upstream_gene_variant ; 1794.0bp to feature; MODIFIER silent_mutation Average:74.143; most accessible tissue: Zhenshan97 panicle, score: 86.058 N N N N
vg0402290226 G -> C LOC_Os04g04780.1 downstream_gene_variant ; 3988.0bp to feature; MODIFIER silent_mutation Average:74.143; most accessible tissue: Zhenshan97 panicle, score: 86.058 N N N N
vg0402290226 G -> C LOC_Os04g04750-LOC_Os04g04770 intergenic_region ; MODIFIER silent_mutation Average:74.143; most accessible tissue: Zhenshan97 panicle, score: 86.058 N N N N
vg0402290226 G -> DEL N N silent_mutation Average:74.143; most accessible tissue: Zhenshan97 panicle, score: 86.058 N N N N
vg0402290226 G -> T LOC_Os04g04770.1 upstream_gene_variant ; 1794.0bp to feature; MODIFIER silent_mutation Average:74.143; most accessible tissue: Zhenshan97 panicle, score: 86.058 N N N N
vg0402290226 G -> T LOC_Os04g04780.1 downstream_gene_variant ; 3988.0bp to feature; MODIFIER silent_mutation Average:74.143; most accessible tissue: Zhenshan97 panicle, score: 86.058 N N N N
vg0402290226 G -> T LOC_Os04g04750-LOC_Os04g04770 intergenic_region ; MODIFIER silent_mutation Average:74.143; most accessible tissue: Zhenshan97 panicle, score: 86.058 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0402290226 G C 0.0 0.0 0.0 0.0 0.0 0.0
vg0402290226 G T 0.0 -0.01 -0.01 0.0 0.0 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0402290226 NA 2.42E-09 mr1352 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402290226 NA 1.10E-06 mr1728 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402290226 1.29E-07 NA mr1798 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402290226 1.30E-07 5.79E-10 mr1798 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402290226 3.71E-06 NA mr1037_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402290226 NA 1.03E-06 mr1126_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402290226 NA 5.93E-09 mr1707_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402290226 1.31E-13 NA mr1798_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402290226 6.59E-12 1.78E-16 mr1798_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251