Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0402280802:

Variant ID: vg0402280802 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 2280802
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TATTATATAGGTTTTAGAATGATTGTGAATTACAAAATCACAGCTTGACTAAAGATGTGAAAACTACTTGAAATACCACCTCAAAGACAGATTTTTCATC[A/G]
ATAGTGTTGATAAGGATCTGTAAAACCATTATTTTCCCAATGGCGTATACAAGCTAATATATATTCCTTGTGTTTCCTCAAACTGTACTGCTGGTCAAGT

Reverse complement sequence

ACTTGACCAGCAGTACAGTTTGAGGAAACACAAGGAATATATATTAGCTTGTATACGCCATTGGGAAAATAATGGTTTTACAGATCCTTATCAACACTAT[T/C]
GATGAAAAATCTGTCTTTGAGGTGGTATTTCAAGTAGTTTTCACATCTTTAGTCAAGCTGTGATTTTGTAATTCACAATCATTCTAAAACCTATATAATA

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	37.50%	5.80%	0.70%	56.05%	NA
All Indica	2759	25.50%	0.50%	0.91%	73.11%	NA
All Japonica	1512	52.80%	15.90%	0.33%	30.95%	NA
Aus	269	81.00%	0.00%	0.37%	18.59%	NA
Indica I	595	6.60%	0.00%	1.68%	91.76%	NA
Indica II	465	5.40%	0.00%	0.43%	94.19%	NA
Indica III	913	47.80%	0.90%	0.55%	50.82%	NA
Indica Intermediate	786	26.00%	0.60%	1.02%	72.39%	NA
Temperate Japonica	767	72.60%	19.20%	0.52%	7.69%	NA
Tropical Japonica	504	22.00%	14.30%	0.20%	63.49%	NA
Japonica Intermediate	241	54.40%	8.70%	0.00%	36.93%	NA
VI/Aromatic	96	18.80%	9.40%	0.00%	71.88%	NA
Intermediate	90	35.60%	12.20%	2.22%	50.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0402280802	A -> DEL	N	N	silent_mutation	Average:12.335; most accessible tissue: Callus, score: 75.364	N	N	N	N
vg0402280802	A -> G	LOC_Os04g04730.1	upstream_gene_variant ; 4761.0bp to feature; MODIFIER	silent_mutation	Average:12.335; most accessible tissue: Callus, score: 75.364	N	N	N	N
vg0402280802	A -> G	LOC_Os04g04740.1	downstream_gene_variant ; 1233.0bp to feature; MODIFIER	silent_mutation	Average:12.335; most accessible tissue: Callus, score: 75.364	N	N	N	N
vg0402280802	A -> G	LOC_Os04g04750.1	downstream_gene_variant ; 1080.0bp to feature; MODIFIER	silent_mutation	Average:12.335; most accessible tissue: Callus, score: 75.364	N	N	N	N
vg0402280802	A -> G	LOC_Os04g04740-LOC_Os04g04750	intergenic_region ; MODIFIER	silent_mutation	Average:12.335; most accessible tissue: Callus, score: 75.364	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0402280802	NA	3.66E-07	mr1077_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402280802	NA	3.12E-07	mr1206_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402280802	NA	4.48E-07	mr1220_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402280802	NA	7.08E-07	mr1229_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402280802	NA	6.16E-06	mr1236_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402280802	NA	2.96E-06	mr1239_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402280802	NA	8.10E-07	mr1252_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402280802	NA	8.60E-06	mr1263_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402280802	9.67E-06	9.66E-06	mr1506_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402280802	2.34E-06	2.34E-06	mr1541_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402280802	3.86E-06	NA	mr1566_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402280802	NA	9.90E-06	mr1668_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402280802	NA	3.22E-06	mr1680_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402280802	NA	1.91E-06	mr1739_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402280802	NA	5.77E-06	mr1763_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402280802	1.67E-06	8.07E-11	mr1784_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402280802	NA	6.50E-07	mr1798_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402280802	NA	2.82E-08	mr1800_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402280802	NA	7.29E-07	mr1844_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251