Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0402263999:

Variant ID: vg0402263999 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 2263999
Reference Allele: C	Alternative Allele: G
Primary Allele: G	Secondary Allele: C

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.95, C: 0.05, others allele: 0.00, population size: 88. )

Flanking Sequence (100 bp) in Reference Genome:

GCCTCAGTTTCAGATAGCTGTTTACATAACTAAGTTCAGGAAAACGACAATGATTACATTAACAGTGGCCACCGACAAAGATGGACGGCCAGATGATGTT[C/G]
ATACCGCTTTGCTCTGATCCGCCACCGTCGGATTTGCATACTCAATATATCTCTCTCCCGTTTCACTGAACTTCTCTGAATCTTCTTATCTCTGAATTTT

Reverse complement sequence

AAAATTCAGAGATAAGAAGATTCAGAGAAGTTCAGTGAAACGGGAGAGAGATATATTGAGTATGCAAATCCGACGGTGGCGGATCAGAGCAAAGCGGTAT[G/C]
AACATCATCTGGCCGTCCATCTTTGTCGGTGGCCACTGTTAATGTAATCATTGTCGTTTTCCTGAACTTAGTTATGTAAACAGCTATCTGAAACTGAGGC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	29.10%	13.70%	0.21%	56.96%	NA
All Indica	2759	23.10%	2.10%	0.25%	74.48%	NA
All Japonica	1512	30.80%	37.80%	0.07%	31.42%	NA
Aus	269	78.10%	3.30%	0.74%	17.84%	NA
Indica I	595	3.00%	2.70%	0.17%	94.12%	NA
Indica II	465	3.20%	1.90%	0.00%	94.84%	NA
Indica III	913	47.40%	0.20%	0.22%	52.14%	NA
Indica Intermediate	786	21.90%	4.10%	0.51%	73.54%	NA
Temperate Japonica	767	24.00%	67.40%	0.00%	8.60%	NA
Tropical Japonica	504	33.30%	3.00%	0.20%	63.49%	NA
Japonica Intermediate	241	46.90%	16.20%	0.00%	36.93%	NA
VI/Aromatic	96	28.10%	0.00%	0.00%	71.88%	NA
Intermediate	90	38.90%	11.10%	0.00%	50.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0402263999	C -> DEL	N	N	silent_mutation	Average:17.656; most accessible tissue: Callus, score: 45.666	N	N	N	N
vg0402263999	C -> G	LOC_Os04g04700.1	upstream_gene_variant ; 3637.0bp to feature; MODIFIER	silent_mutation	Average:17.656; most accessible tissue: Callus, score: 45.666	N	N	N	N
vg0402263999	C -> G	LOC_Os04g04710.1	upstream_gene_variant ; 625.0bp to feature; MODIFIER	silent_mutation	Average:17.656; most accessible tissue: Callus, score: 45.666	N	N	N	N
vg0402263999	C -> G	LOC_Os04g04720.1	upstream_gene_variant ; 2885.0bp to feature; MODIFIER	silent_mutation	Average:17.656; most accessible tissue: Callus, score: 45.666	N	N	N	N
vg0402263999	C -> G	LOC_Os04g04710-LOC_Os04g04720	intergenic_region ; MODIFIER	silent_mutation	Average:17.656; most accessible tissue: Callus, score: 45.666	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0402263999	NA	2.75E-12	mr1182	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402263999	NA	8.61E-11	mr1282	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402263999	NA	5.39E-06	mr1330	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402263999	NA	5.41E-13	mr1650	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402263999	NA	3.36E-10	mr1658	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402263999	5.90E-07	3.87E-09	mr1681	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402263999	NA	2.92E-06	mr1977	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402263999	NA	6.27E-07	mr1077_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402263999	NA	1.33E-06	mr1149_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402263999	NA	1.14E-06	mr1206_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402263999	NA	1.76E-07	mr1229_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402263999	NA	1.46E-08	mr1229_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402263999	NA	3.46E-08	mr1441_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402263999	NA	7.59E-09	mr1521_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402263999	NA	7.18E-06	mr1550_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402263999	NA	2.83E-06	mr1555_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402263999	NA	2.90E-06	mr1596_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402263999	NA	4.96E-06	mr1627_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402263999	NA	2.73E-07	mr1748_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402263999	NA	1.30E-06	mr1763_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402263999	NA	3.43E-06	mr1763_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402263999	NA	9.02E-06	mr1844_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402263999	NA	2.44E-08	mr1880_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402263999	NA	1.30E-09	mr1880_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251