Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0402256057:

Variant ID: vg0402256057 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 2256057
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 72. )

Flanking Sequence (100 bp) in Reference Genome:

GATGGTCATGGAACCACACAGGGAGGCGACCAGCATCCGTGTGCTGCTGTTGAAGGAGATGTAGGATGTCATGCTCCCCTCCAGTCTCGTGTTGCCGGGC[A/G]
AGACTGTTGAGTAGTTAGGCTCCCTAACAGAACTGATGCCGATGCAGATACGGTCGTTGCTAGTATCATTTTCGTAATTGTACGTGACGACGAACTCGAC

Reverse complement sequence

GTCGAGTTCGTCGTCACGTACAATTACGAAAATGATACTAGCAACGACCGTATCTGCATCGGCATCAGTTCTGTTAGGGAGCCTAACTACTCAACAGTCT[T/C]
GCCCGGCAACACGAGACTGGAGGGGAGCATGACATCCTACATCTCCTTCAACAGCAGCACACGGATGCTGGTCGCCTCCCTGTGTGGTTCCATGACCATC

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	39.20%	36.20%	3.26%	21.29%	NA
All Indica	2759	24.20%	53.90%	4.13%	17.76%	NA
All Japonica	1512	58.90%	10.00%	1.92%	29.17%	NA
Aus	269	82.50%	3.00%	0.74%	13.75%	NA
Indica I	595	6.90%	76.80%	5.21%	11.09%	NA
Indica II	465	6.00%	75.90%	2.80%	15.27%	NA
Indica III	913	44.70%	31.20%	2.96%	21.14%	NA
Indica Intermediate	786	24.30%	49.90%	5.47%	20.36%	NA
Temperate Japonica	767	88.30%	0.40%	0.13%	11.21%	NA
Tropical Japonica	504	29.20%	25.20%	3.57%	42.06%	NA
Japonica Intermediate	241	27.80%	8.70%	4.15%	59.34%	NA
VI/Aromatic	96	30.20%	35.40%	7.29%	27.08%	NA
Intermediate	90	48.90%	35.60%	2.22%	13.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0402256057	A -> DEL	LOC_Os04g04690.1	N	frameshift_variant	Average:51.18; most accessible tissue: Callus, score: 85.137	N	N	N	N
vg0402256057	A -> G	LOC_Os04g04690.1	missense_variant ; p.Leu173Ser; MODERATE	nonsynonymous_codon ; L173S	Average:51.18; most accessible tissue: Callus, score: 85.137	unknown	unknown	TOLERATED	0.10

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0402256057	NA	5.25E-08	mr1037	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402256057	NA	4.90E-08	mr1068	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402256057	NA	1.34E-09	mr1108	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402256057	NA	5.83E-08	mr1111	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402256057	NA	9.23E-10	mr1112	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402256057	NA	6.61E-07	mr1181	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402256057	NA	6.41E-06	mr1187	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402256057	NA	7.82E-06	mr1212	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402256057	NA	2.50E-09	mr1234	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402256057	NA	4.33E-09	mr1237	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402256057	NA	5.67E-13	mr1270	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402256057	5.70E-06	9.13E-09	mr1285	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402256057	NA	3.08E-08	mr1403	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402256057	NA	5.26E-06	mr1432	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402256057	2.70E-06	NA	mr1501	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402256057	3.19E-06	NA	mr1523	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402256057	NA	2.42E-06	mr1568	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402256057	NA	8.56E-06	mr1576	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402256057	NA	1.27E-13	mr1592	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402256057	NA	4.31E-08	mr1666	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402256057	NA	3.07E-08	mr1716	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402256057	NA	9.72E-09	mr1717	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402256057	NA	1.40E-07	mr1748	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402256057	NA	5.11E-11	mr1770	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402256057	9.88E-06	9.88E-06	mr1777	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402256057	NA	6.20E-08	mr1785	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402256057	2.00E-09	5.81E-54	mr1798	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402256057	NA	1.56E-09	mr1798	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402256057	NA	1.88E-07	mr1798	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402256057	NA	1.98E-08	mr1946	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402256057	NA	1.66E-06	mr1144_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251