Variant ID: vg0402252227 (JBrowse) | Variation Type: SNP |
Chromosome: chr04 | Position: 2252227 |
Reference Allele: A | Alternative Allele: G |
Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.91, A: 0.09, others allele: 0.00, population size: 68. )
GACCATGCACGTCATTGGCACCGCAATGTCATCGCCTACCCCGGCAACCACTATCCTTCGCCTGGAACACCACCTCCCGTGATGCCTCTCCCTCTGCCTC[A/G]
CCAGCACTTCCTCTGGTAGCCATTGCAACCTCGCAGAACACCGCCCCGTTACGCAACCACCACTCAAAAACGTAGAGGCGTTCTCCTCCCCGGTCTCGCT
AGCGAGACCGGGGAGGAGAACGCCTCTACGTTTTTGAGTGGTGGTTGCGTAACGGGGCGGTGTTCTGCGAGGTTGCAATGGCTACCAGAGGAAGTGCTGG[T/C]
GAGGCAGAGGGAGAGGCATCACGGGAGGTGGTGTTCCAGGCGAAGGATAGTGGTTGCCGGGGTAGGCGATGACATTGCGGTGCCAATGACGTGCATGGTC
Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 55.70% | 18.90% | 1.12% | 24.31% | NA |
All Indica | 2759 | 75.80% | 1.80% | 1.49% | 20.99% | NA |
All Japonica | 1512 | 16.10% | 53.30% | 0.60% | 29.96% | NA |
Aus | 269 | 81.40% | 2.20% | 0.74% | 15.61% | NA |
Indica I | 595 | 93.40% | 0.80% | 0.67% | 5.04% | NA |
Indica II | 465 | 96.60% | 1.30% | 0.43% | 1.72% | NA |
Indica III | 913 | 57.80% | 1.20% | 1.20% | 39.76% | NA |
Indica Intermediate | 786 | 70.90% | 3.40% | 3.05% | 22.65% | NA |
Temperate Japonica | 767 | 1.60% | 86.80% | 0.39% | 11.21% | NA |
Tropical Japonica | 504 | 41.50% | 16.70% | 0.79% | 41.07% | NA |
Japonica Intermediate | 241 | 9.50% | 23.20% | 0.83% | 66.39% | NA |
VI/Aromatic | 96 | 25.00% | 9.40% | 0.00% | 65.62% | NA |
Intermediate | 90 | 62.20% | 23.30% | 1.11% | 13.33% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg0402252227 | A -> DEL | LOC_Os04g04670.1 | N | frameshift_variant | Average:68.117; most accessible tissue: Zhenshan97 young leaf, score: 91.232 | N | N | N | N |
vg0402252227 | A -> G | LOC_Os04g04670.1 | synonymous_variant ; p.Gly8Gly; LOW | synonymous_codon | Average:68.117; most accessible tissue: Zhenshan97 young leaf, score: 91.232 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg0402252227 | NA | 1.04E-12 | mr1010 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0402252227 | 9.23E-06 | 9.23E-06 | mr1261 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0402252227 | 5.56E-06 | NA | mr1392 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0402252227 | 1.21E-06 | NA | mr1546 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0402252227 | NA | 1.51E-06 | mr1546 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0402252227 | NA | 7.88E-07 | mr1627 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0402252227 | NA | 3.50E-09 | mr1663 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0402252227 | NA | 9.77E-07 | mr1785 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0402252227 | NA | 1.78E-09 | mr1977 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0402252227 | NA | 2.58E-06 | mr1977 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0402252227 | NA | 3.35E-07 | mr1837_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |