Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0402237717:

Variant ID: vg0402237717 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 2237717
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.01, others allele: 0.00, population size: 92. )

Flanking Sequence (100 bp) in Reference Genome:


AAATTAGGAACTATCCCTTCCAACACTCCATTTTTACAAGCTTCCTCTAGTATAGCTTAAAGTGCATCCCCTACTAGATCGAAAAGAATAGGTGACAGTG[G/A]
GTCTCCCTGCCTAAGCCCACTATAGGTTTTAAAGAAAGGTCCTGCCTCTCCATTGATGTTCATCCCTACGTTACCCCCCTCATTGATGTTCTTAGGCTGA

Reverse complement sequence

TCAGCCTAAGAACATCAATGAGGGGGGTAACGTAGGGATGAACATCAATGGAGAGGCAGGACCTTTCTTTAAAACCTATAGTGGGCTTAGGCAGGGAGAC[C/T]
CACTGTCACCTATTCTTTTCGATCTAGTAGGGGATGCACTTTAAGCTATACTAGAGGAAGCTTGTAAAAATGGAGTGTTGGAAGGGATAGTTCCTAATTT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 44.20% 43.10% 0.51% 12.19% NA
All Indica  2759 66.00% 24.40% 0.36% 9.24% NA
All Japonica  1512 13.20% 69.80% 0.60% 16.47% NA
Aus  269 5.60% 85.50% 0.37% 8.55% NA
Indica I  595 92.40% 5.90% 0.17% 1.51% NA
Indica II  465 94.00% 4.90% 0.00% 1.08% NA
Indica III  913 37.10% 44.90% 0.44% 17.52% NA
Indica Intermediate  786 63.10% 26.00% 0.64% 10.31% NA
Temperate Japonica  767 1.40% 95.60% 0.13% 2.87% NA
Tropical Japonica  504 33.30% 38.30% 0.79% 27.58% NA
Japonica Intermediate  241 8.30% 53.50% 1.66% 36.51% NA
VI/Aromatic  96 10.40% 39.60% 3.12% 46.88% NA
Intermediate  90 48.90% 45.60% 1.11% 4.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0402237717 G -> DEL N N silent_mutation Average:32.189; most accessible tissue: Zhenshan97 young leaf, score: 59.612 N N N N
vg0402237717 G -> A LOC_Os04g04640.1 upstream_gene_variant ; 3457.0bp to feature; MODIFIER silent_mutation Average:32.189; most accessible tissue: Zhenshan97 young leaf, score: 59.612 N N N N
vg0402237717 G -> A LOC_Os04g04650.1 downstream_gene_variant ; 264.0bp to feature; MODIFIER silent_mutation Average:32.189; most accessible tissue: Zhenshan97 young leaf, score: 59.612 N N N N
vg0402237717 G -> A LOC_Os04g04650-LOC_Os04g04660 intergenic_region ; MODIFIER silent_mutation Average:32.189; most accessible tissue: Zhenshan97 young leaf, score: 59.612 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0402237717 NA 9.79E-06 mr1030 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402237717 NA 4.17E-26 mr1037 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402237717 5.97E-06 4.97E-11 mr1037 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402237717 NA 1.03E-07 mr1045 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402237717 NA 8.19E-07 mr1053 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402237717 NA 4.70E-35 mr1094 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402237717 NA 5.41E-07 mr1094 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402237717 NA 2.55E-07 mr1111 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402237717 NA 6.36E-08 mr1112 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402237717 NA 2.42E-06 mr1126 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402237717 NA 1.18E-06 mr1144 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402237717 NA 8.76E-16 mr1147 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402237717 NA 4.73E-06 mr1187 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402237717 NA 8.17E-09 mr1213 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402237717 NA 5.63E-07 mr1229 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402237717 NA 2.05E-07 mr1237 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402237717 NA 9.03E-21 mr1244 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402237717 NA 1.37E-14 mr1270 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402237717 1.83E-06 2.07E-09 mr1285 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402237717 NA 8.66E-06 mr1311 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402237717 NA 5.95E-12 mr1409 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402237717 NA 2.73E-06 mr1432 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402237717 NA 3.33E-08 mr1446 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402237717 NA 1.03E-10 mr1539 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402237717 NA 6.76E-15 mr1540 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402237717 NA 3.88E-06 mr1568 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402237717 NA 1.74E-06 mr1614 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402237717 NA 3.01E-08 mr1666 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402237717 NA 8.22E-09 mr1716 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402237717 NA 4.84E-08 mr1717 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402237717 NA 2.53E-06 mr1727 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402237717 NA 1.98E-14 mr1732 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402237717 NA 6.96E-08 mr1748 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402237717 NA 2.83E-07 mr1763 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402237717 NA 1.31E-10 mr1770 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402237717 NA 1.27E-07 mr1785 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402237717 2.05E-06 NA mr1798 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402237717 NA 1.24E-09 mr1798 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402237717 NA 1.09E-07 mr1872 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402237717 NA 1.31E-07 mr1946 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402237717 NA 1.53E-08 mr1989 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402237717 NA 1.43E-07 mr1037_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402237717 NA 1.76E-08 mr1126_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402237717 NA 3.03E-07 mr1144_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402237717 NA 6.72E-10 mr1649_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402237717 NA 4.45E-13 mr1798_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251