\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0402123330:

Variant ID: vg0402123330 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 2123330
Reference Allele: TAlternative Allele: G
Primary Allele: TSecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TACTCCGATACCACTCTATATTAAGATATCACAGCAAATAAAATATACCAAACGAAAGCCTAATATACTTAAATGCGACAAGATCTTAATATAAAGGGCA[T/G]
ATTTAAGATGTCAATCAAGCATATGAAATAAATGTAGTTAAATCAGGTAAGATCGGCTGAAACTCCGATACTACCCTAATCAGCAACCAAAGACAGGCTA

Reverse complement sequence

TAGCCTGTCTTTGGTTGCTGATTAGGGTAGTATCGGAGTTTCAGCCGATCTTACCTGATTTAACTACATTTATTTCATATGCTTGATTGACATCTTAAAT[A/C]
TGCCCTTTATATTAAGATCTTGTCGCATTTAAGTATATTAGGCTTTCGTTTGGTATATTTTATTTGCTGTGATATCTTAATATAGAGTGGTATCGGAGTA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 15.10% 14.50% 1.61% 68.83% NA
All Indica  2759 6.90% 12.50% 2.17% 78.47% NA
All Japonica  1512 33.10% 20.70% 0.66% 45.50% NA
Aus  269 3.70% 0.40% 1.12% 94.80% NA
Indica I  595 15.80% 2.50% 0.84% 80.84% NA
Indica II  465 8.60% 1.90% 0.86% 88.60% NA
Indica III  913 0.70% 23.00% 4.27% 72.07% NA
Indica Intermediate  786 6.20% 14.10% 1.53% 78.12% NA
Temperate Japonica  767 58.50% 28.20% 1.04% 12.26% NA
Tropical Japonica  504 3.00% 14.90% 0.20% 81.94% NA
Japonica Intermediate  241 15.40% 9.10% 0.41% 75.10% NA
VI/Aromatic  96 1.00% 10.40% 0.00% 88.54% NA
Intermediate  90 13.30% 16.70% 3.33% 66.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0402123330 T -> DEL N N silent_mutation Average:7.557; most accessible tissue: Callus, score: 14.79 N N N N
vg0402123330 T -> G LOC_Os04g04460.1 upstream_gene_variant ; 605.0bp to feature; MODIFIER silent_mutation Average:7.557; most accessible tissue: Callus, score: 14.79 N N N N
vg0402123330 T -> G LOC_Os04g04470.1 downstream_gene_variant ; 893.0bp to feature; MODIFIER silent_mutation Average:7.557; most accessible tissue: Callus, score: 14.79 N N N N
vg0402123330 T -> G LOC_Os04g04460-LOC_Os04g04470 intergenic_region ; MODIFIER silent_mutation Average:7.557; most accessible tissue: Callus, score: 14.79 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0402123330 NA 7.74E-06 mr1004 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402123330 NA 6.15E-06 mr1077 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402123330 NA 6.75E-07 mr1164 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402123330 NA 6.41E-08 mr1205 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402123330 NA 1.96E-07 mr1252 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402123330 NA 2.39E-06 mr1555 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402123330 NA 1.59E-07 mr1045_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402123330 NA 2.14E-06 mr1077_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402123330 NA 1.43E-06 mr1206_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402123330 NA 2.43E-07 mr1229_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402123330 NA 3.13E-08 mr1229_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402123330 NA 3.10E-08 mr1252_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402123330 NA 2.58E-06 mr1555_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402123330 NA 6.06E-06 mr1596_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402123330 NA 4.48E-06 mr1596_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402123330 NA 4.32E-06 mr1763_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402123330 NA 4.48E-06 mr1763_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402123330 NA 3.56E-07 mr1880_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402123330 NA 1.24E-08 mr1880_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251