Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0402123330:

Variant ID: vg0402123330 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 2123330
Reference Allele: T	Alternative Allele: G
Primary Allele: T	Secondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TACTCCGATACCACTCTATATTAAGATATCACAGCAAATAAAATATACCAAACGAAAGCCTAATATACTTAAATGCGACAAGATCTTAATATAAAGGGCA[T/G]
ATTTAAGATGTCAATCAAGCATATGAAATAAATGTAGTTAAATCAGGTAAGATCGGCTGAAACTCCGATACTACCCTAATCAGCAACCAAAGACAGGCTA

Reverse complement sequence

TAGCCTGTCTTTGGTTGCTGATTAGGGTAGTATCGGAGTTTCAGCCGATCTTACCTGATTTAACTACATTTATTTCATATGCTTGATTGACATCTTAAAT[A/C]
TGCCCTTTATATTAAGATCTTGTCGCATTTAAGTATATTAGGCTTTCGTTTGGTATATTTTATTTGCTGTGATATCTTAATATAGAGTGGTATCGGAGTA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	15.10%	14.50%	1.61%	68.83%	NA
All Indica	2759	6.90%	12.50%	2.17%	78.47%	NA
All Japonica	1512	33.10%	20.70%	0.66%	45.50%	NA
Aus	269	3.70%	0.40%	1.12%	94.80%	NA
Indica I	595	15.80%	2.50%	0.84%	80.84%	NA
Indica II	465	8.60%	1.90%	0.86%	88.60%	NA
Indica III	913	0.70%	23.00%	4.27%	72.07%	NA
Indica Intermediate	786	6.20%	14.10%	1.53%	78.12%	NA
Temperate Japonica	767	58.50%	28.20%	1.04%	12.26%	NA
Tropical Japonica	504	3.00%	14.90%	0.20%	81.94%	NA
Japonica Intermediate	241	15.40%	9.10%	0.41%	75.10%	NA
VI/Aromatic	96	1.00%	10.40%	0.00%	88.54%	NA
Intermediate	90	13.30%	16.70%	3.33%	66.67%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0402123330	T -> DEL	N	N	silent_mutation	Average:7.557; most accessible tissue: Callus, score: 14.79	N	N	N	N
vg0402123330	T -> G	LOC_Os04g04460.1	upstream_gene_variant ; 605.0bp to feature; MODIFIER	silent_mutation	Average:7.557; most accessible tissue: Callus, score: 14.79	N	N	N	N
vg0402123330	T -> G	LOC_Os04g04470.1	downstream_gene_variant ; 893.0bp to feature; MODIFIER	silent_mutation	Average:7.557; most accessible tissue: Callus, score: 14.79	N	N	N	N
vg0402123330	T -> G	LOC_Os04g04460-LOC_Os04g04470	intergenic_region ; MODIFIER	silent_mutation	Average:7.557; most accessible tissue: Callus, score: 14.79	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0402123330	NA	7.74E-06	mr1004	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402123330	NA	6.15E-06	mr1077	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402123330	NA	6.75E-07	mr1164	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402123330	NA	6.41E-08	mr1205	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402123330	NA	1.96E-07	mr1252	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402123330	NA	2.39E-06	mr1555	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402123330	NA	1.59E-07	mr1045_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402123330	NA	2.14E-06	mr1077_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402123330	NA	1.43E-06	mr1206_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402123330	NA	2.43E-07	mr1229_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402123330	NA	3.13E-08	mr1229_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402123330	NA	3.10E-08	mr1252_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402123330	NA	2.58E-06	mr1555_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402123330	NA	6.06E-06	mr1596_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402123330	NA	4.48E-06	mr1596_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402123330	NA	4.32E-06	mr1763_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402123330	NA	4.48E-06	mr1763_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402123330	NA	3.56E-07	mr1880_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402123330	NA	1.24E-08	mr1880_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251