\
| Variant ID: vg0402032946 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 2032946 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, T: 0.01, others allele: 0.00, population size: 236. )
GTGCAAGTCAAAGAAGCCATTGGTTTGCTTGCGAAGCTTGTTGAAACATTTTGTTCCAAGAAAGATTGAACTGAAGAAAAGTCTTAATGTGGCTTATTTT[C/T]
CTATGAAATTGATAATAAATGCAATCCTATGAAGATTTTCAAATCCTTCCCTTGAATCAAAGGAGCCTACATGAAAAAGAATCCATTGGGAATTGAAATC
GATTTCAATTCCCAATGGATTCTTTTTCATGTAGGCTCCTTTGATTCAAGGGAAGGATTTGAAAATCTTCATAGGATTGCATTTATTATCAATTTCATAG[G/A]
AAAATAAGCCACATTAAGACTTTTCTTCAGTTCAATCTTTCTTGGAACAAAATGTTTCAACAAGCTTCGCAAGCAAACCAATGGCTTCTTTGACTTGCAC
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 52.70% | 47.10% | 0.19% | 0.04% | NA |
| All Indica | 2759 | 78.00% | 21.60% | 0.29% | 0.07% | NA |
| All Japonica | 1512 | 11.80% | 88.20% | 0.00% | 0.00% | NA |
| Aus | 269 | 38.70% | 61.30% | 0.00% | 0.00% | NA |
| Indica I | 595 | 87.10% | 12.60% | 0.34% | 0.00% | NA |
| Indica II | 465 | 92.50% | 7.30% | 0.00% | 0.22% | NA |
| Indica III | 913 | 62.50% | 37.00% | 0.33% | 0.11% | NA |
| Indica Intermediate | 786 | 80.70% | 19.00% | 0.38% | 0.00% | NA |
| Temperate Japonica | 767 | 0.40% | 99.60% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 31.90% | 68.10% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 5.80% | 94.20% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 5.20% | 94.80% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 55.60% | 43.30% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0402032946 | C -> DEL | N | N | silent_mutation | Average:42.632; most accessible tissue: Callus, score: 69.361 | N | N | N | N |
| vg0402032946 | C -> T | LOC_Os04g04330.1 | upstream_gene_variant ; 1504.0bp to feature; MODIFIER | silent_mutation | Average:42.632; most accessible tissue: Callus, score: 69.361 | N | N | N | N |
| vg0402032946 | C -> T | LOC_Os04g04330.2 | upstream_gene_variant ; 1527.0bp to feature; MODIFIER | silent_mutation | Average:42.632; most accessible tissue: Callus, score: 69.361 | N | N | N | N |
| vg0402032946 | C -> T | LOC_Os04g04320-LOC_Os04g04330 | intergenic_region ; MODIFIER | silent_mutation | Average:42.632; most accessible tissue: Callus, score: 69.361 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0402032946 | 1.08E-10 | 9.08E-50 | mr1798 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0402032946 | 3.42E-07 | 5.34E-08 | mr1798 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0402032946 | 6.11E-07 | 2.68E-09 | mr1798 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0402032946 | 7.03E-15 | 7.65E-69 | mr1798_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0402032946 | 2.65E-07 | 1.60E-11 | mr1798_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0402032946 | 4.91E-11 | 1.22E-15 | mr1798_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |