\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0402032946:

Variant ID: vg0402032946 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 2032946
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, T: 0.01, others allele: 0.00, population size: 236. )

Flanking Sequence (100 bp) in Reference Genome:


GTGCAAGTCAAAGAAGCCATTGGTTTGCTTGCGAAGCTTGTTGAAACATTTTGTTCCAAGAAAGATTGAACTGAAGAAAAGTCTTAATGTGGCTTATTTT[C/T]
CTATGAAATTGATAATAAATGCAATCCTATGAAGATTTTCAAATCCTTCCCTTGAATCAAAGGAGCCTACATGAAAAAGAATCCATTGGGAATTGAAATC

Reverse complement sequence

GATTTCAATTCCCAATGGATTCTTTTTCATGTAGGCTCCTTTGATTCAAGGGAAGGATTTGAAAATCTTCATAGGATTGCATTTATTATCAATTTCATAG[G/A]
AAAATAAGCCACATTAAGACTTTTCTTCAGTTCAATCTTTCTTGGAACAAAATGTTTCAACAAGCTTCGCAAGCAAACCAATGGCTTCTTTGACTTGCAC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 52.70% 47.10% 0.19% 0.04% NA
All Indica  2759 78.00% 21.60% 0.29% 0.07% NA
All Japonica  1512 11.80% 88.20% 0.00% 0.00% NA
Aus  269 38.70% 61.30% 0.00% 0.00% NA
Indica I  595 87.10% 12.60% 0.34% 0.00% NA
Indica II  465 92.50% 7.30% 0.00% 0.22% NA
Indica III  913 62.50% 37.00% 0.33% 0.11% NA
Indica Intermediate  786 80.70% 19.00% 0.38% 0.00% NA
Temperate Japonica  767 0.40% 99.60% 0.00% 0.00% NA
Tropical Japonica  504 31.90% 68.10% 0.00% 0.00% NA
Japonica Intermediate  241 5.80% 94.20% 0.00% 0.00% NA
VI/Aromatic  96 5.20% 94.80% 0.00% 0.00% NA
Intermediate  90 55.60% 43.30% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0402032946 C -> DEL N N silent_mutation Average:42.632; most accessible tissue: Callus, score: 69.361 N N N N
vg0402032946 C -> T LOC_Os04g04330.1 upstream_gene_variant ; 1504.0bp to feature; MODIFIER silent_mutation Average:42.632; most accessible tissue: Callus, score: 69.361 N N N N
vg0402032946 C -> T LOC_Os04g04330.2 upstream_gene_variant ; 1527.0bp to feature; MODIFIER silent_mutation Average:42.632; most accessible tissue: Callus, score: 69.361 N N N N
vg0402032946 C -> T LOC_Os04g04320-LOC_Os04g04330 intergenic_region ; MODIFIER silent_mutation Average:42.632; most accessible tissue: Callus, score: 69.361 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0402032946 1.08E-10 9.08E-50 mr1798 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402032946 3.42E-07 5.34E-08 mr1798 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402032946 6.11E-07 2.68E-09 mr1798 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402032946 7.03E-15 7.65E-69 mr1798_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402032946 2.65E-07 1.60E-11 mr1798_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402032946 4.91E-11 1.22E-15 mr1798_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251