Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0402032946:

Variant ID: vg0402032946 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 2032946
Reference Allele: C	Alternative Allele: T
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, T: 0.01, others allele: 0.00, population size: 236. )

Flanking Sequence (100 bp) in Reference Genome:

GTGCAAGTCAAAGAAGCCATTGGTTTGCTTGCGAAGCTTGTTGAAACATTTTGTTCCAAGAAAGATTGAACTGAAGAAAAGTCTTAATGTGGCTTATTTT[C/T]
CTATGAAATTGATAATAAATGCAATCCTATGAAGATTTTCAAATCCTTCCCTTGAATCAAAGGAGCCTACATGAAAAAGAATCCATTGGGAATTGAAATC

Reverse complement sequence

GATTTCAATTCCCAATGGATTCTTTTTCATGTAGGCTCCTTTGATTCAAGGGAAGGATTTGAAAATCTTCATAGGATTGCATTTATTATCAATTTCATAG[G/A]
AAAATAAGCCACATTAAGACTTTTCTTCAGTTCAATCTTTCTTGGAACAAAATGTTTCAACAAGCTTCGCAAGCAAACCAATGGCTTCTTTGACTTGCAC

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	52.70%	47.10%	0.19%	0.04%	NA
All Indica	2759	78.00%	21.60%	0.29%	0.07%	NA
All Japonica	1512	11.80%	88.20%	0.00%	0.00%	NA
Aus	269	38.70%	61.30%	0.00%	0.00%	NA
Indica I	595	87.10%	12.60%	0.34%	0.00%	NA
Indica II	465	92.50%	7.30%	0.00%	0.22%	NA
Indica III	913	62.50%	37.00%	0.33%	0.11%	NA
Indica Intermediate	786	80.70%	19.00%	0.38%	0.00%	NA
Temperate Japonica	767	0.40%	99.60%	0.00%	0.00%	NA
Tropical Japonica	504	31.90%	68.10%	0.00%	0.00%	NA
Japonica Intermediate	241	5.80%	94.20%	0.00%	0.00%	NA
VI/Aromatic	96	5.20%	94.80%	0.00%	0.00%	NA
Intermediate	90	55.60%	43.30%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0402032946	C -> DEL	N	N	silent_mutation	Average:42.632; most accessible tissue: Callus, score: 69.361	N	N	N	N
vg0402032946	C -> T	LOC_Os04g04330.1	upstream_gene_variant ; 1504.0bp to feature; MODIFIER	silent_mutation	Average:42.632; most accessible tissue: Callus, score: 69.361	N	N	N	N
vg0402032946	C -> T	LOC_Os04g04330.2	upstream_gene_variant ; 1527.0bp to feature; MODIFIER	silent_mutation	Average:42.632; most accessible tissue: Callus, score: 69.361	N	N	N	N
vg0402032946	C -> T	LOC_Os04g04320-LOC_Os04g04330	intergenic_region ; MODIFIER	silent_mutation	Average:42.632; most accessible tissue: Callus, score: 69.361	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0402032946	1.08E-10	9.08E-50	mr1798	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402032946	3.42E-07	5.34E-08	mr1798	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402032946	6.11E-07	2.68E-09	mr1798	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402032946	7.03E-15	7.65E-69	mr1798_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402032946	2.65E-07	1.60E-11	mr1798_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402032946	4.91E-11	1.22E-15	mr1798_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251