| Variant ID: vg0401947660 (JBrowse) | Variation Type: INDEL |
| Chromosome: chr04 | Position: 1947660 |
| Reference Allele: G | Alternative Allele: T,A,GA |
| Primary Allele: G | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
TCAACCCGCCCCCGGGGGGCGGTTTTTGCAGGCGCCGCCACAAGCGGCCCGCATAGAACCTACCGACCCCCTCGTACAGAAAAACGATTTTTGTAGTAGT[G/T,A,GA]
GTTGCCGCCGCAGGTGCAGAAGAAGCCACCGCCGGATGCCGCCATCTTCGAGGGGATGCCGACGCGAGTCGCGGTGGCGAGACGCAGGCGACCCTTACGC
GCGTAAGGGTCGCCTGCGTCTCGCCACCGCGACTCGCGTCGGCATCCCCTCGAAGATGGCGGCATCCGGCGGTGGCTTCTTCTGCACCTGCGGCGGCAAC[C/A,T,TC]
ACTACTACAAAAATCGTTTTTCTGTACGAGGGGGTCGGTAGGTTCTATGCGGGCCGCTTGTGGCGGCGCCTGCAAAAACCGCCCCCCGGGGGCGGGTTGA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 88.00% | 4.90% | 0.49% | 3.45% | A: 3.09%; GA: 0.04% |
| All Indica | 2759 | 92.60% | 0.20% | 0.14% | 5.65% | A: 1.30%; GA: 0.07% |
| All Japonica | 1512 | 80.90% | 14.50% | 0.33% | 0.13% | A: 4.17% |
| Aus | 269 | 88.80% | 0.00% | 5.20% | 0.00% | A: 5.95% |
| Indica I | 595 | 92.10% | 0.00% | 0.17% | 7.56% | GA: 0.17% |
| Indica II | 465 | 98.90% | 0.40% | 0.00% | 0.43% | A: 0.22% |
| Indica III | 913 | 91.00% | 0.10% | 0.22% | 6.13% | A: 2.52% |
| Indica Intermediate | 786 | 91.10% | 0.40% | 0.13% | 6.74% | A: 1.53%; GA: 0.13% |
| Temperate Japonica | 767 | 92.70% | 2.00% | 0.13% | 0.00% | A: 5.22% |
| Tropical Japonica | 504 | 68.10% | 30.80% | 0.20% | 0.00% | A: 0.99% |
| Japonica Intermediate | 241 | 70.10% | 20.30% | 1.24% | 0.83% | A: 7.47% |
| VI/Aromatic | 96 | 64.60% | 4.20% | 0.00% | 0.00% | A: 31.25% |
| Intermediate | 90 | 91.10% | 2.20% | 0.00% | 5.56% | A: 1.11% |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0401947660 | G -> DEL | N | N | silent_mutation | Average:62.781; most accessible tissue: Zhenshan97 flag leaf, score: 80.156 | N | N | N | N |
| vg0401947660 | G -> A | LOC_Os04g04190.1 | upstream_gene_variant ; 1691.0bp to feature; MODIFIER | silent_mutation | Average:62.781; most accessible tissue: Zhenshan97 flag leaf, score: 80.156 | N | N | N | N |
| vg0401947660 | G -> A | LOC_Os04g04180.1 | intron_variant ; MODIFIER | silent_mutation | Average:62.781; most accessible tissue: Zhenshan97 flag leaf, score: 80.156 | N | N | N | N |
| vg0401947660 | G -> GA | LOC_Os04g04190.1 | upstream_gene_variant ; 1690.0bp to feature; MODIFIER | silent_mutation | Average:62.781; most accessible tissue: Zhenshan97 flag leaf, score: 80.156 | N | N | N | N |
| vg0401947660 | G -> GA | LOC_Os04g04180.1 | intron_variant ; MODIFIER | silent_mutation | Average:62.781; most accessible tissue: Zhenshan97 flag leaf, score: 80.156 | N | N | N | N |
| vg0401947660 | G -> T | LOC_Os04g04190.1 | upstream_gene_variant ; 1691.0bp to feature; MODIFIER | silent_mutation | Average:62.781; most accessible tissue: Zhenshan97 flag leaf, score: 80.156 | N | N | N | N |
| vg0401947660 | G -> T | LOC_Os04g04180.1 | intron_variant ; MODIFIER | silent_mutation | Average:62.781; most accessible tissue: Zhenshan97 flag leaf, score: 80.156 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0401947660 | 2.11E-06 | 5.39E-08 | mr1155 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0401947660 | NA | 3.88E-06 | mr1213 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0401947660 | NA | 6.56E-06 | mr1225 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0401947660 | NA | 1.52E-12 | mr1410 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0401947660 | NA | 7.42E-08 | mr1746 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0401947660 | NA | 7.68E-07 | mr1805 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0401947660 | NA | 4.29E-06 | mr1228_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0401947660 | NA | 3.33E-16 | mr1301_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0401947660 | NA | 7.95E-13 | mr1410_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0401947660 | NA | 5.59E-06 | mr1606_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0401947660 | 4.46E-07 | NA | mr1798_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0401947660 | NA | 3.66E-07 | mr1905_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |