\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0401947660:

Variant ID: vg0401947660 (JBrowse)Variation Type: INDEL
Chromosome: chr04Position: 1947660
Reference Allele: GAlternative Allele: T,A,GA
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TCAACCCGCCCCCGGGGGGCGGTTTTTGCAGGCGCCGCCACAAGCGGCCCGCATAGAACCTACCGACCCCCTCGTACAGAAAAACGATTTTTGTAGTAGT[G/T,A,GA]
GTTGCCGCCGCAGGTGCAGAAGAAGCCACCGCCGGATGCCGCCATCTTCGAGGGGATGCCGACGCGAGTCGCGGTGGCGAGACGCAGGCGACCCTTACGC

Reverse complement sequence

GCGTAAGGGTCGCCTGCGTCTCGCCACCGCGACTCGCGTCGGCATCCCCTCGAAGATGGCGGCATCCGGCGGTGGCTTCTTCTGCACCTGCGGCGGCAAC[C/A,T,TC]
ACTACTACAAAAATCGTTTTTCTGTACGAGGGGGTCGGTAGGTTCTATGCGGGCCGCTTGTGGCGGCGCCTGCAAAAACCGCCCCCCGGGGGCGGGTTGA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 88.00% 4.90% 0.49% 3.45% A: 3.09%; GA: 0.04%
All Indica  2759 92.60% 0.20% 0.14% 5.65% A: 1.30%; GA: 0.07%
All Japonica  1512 80.90% 14.50% 0.33% 0.13% A: 4.17%
Aus  269 88.80% 0.00% 5.20% 0.00% A: 5.95%
Indica I  595 92.10% 0.00% 0.17% 7.56% GA: 0.17%
Indica II  465 98.90% 0.40% 0.00% 0.43% A: 0.22%
Indica III  913 91.00% 0.10% 0.22% 6.13% A: 2.52%
Indica Intermediate  786 91.10% 0.40% 0.13% 6.74% A: 1.53%; GA: 0.13%
Temperate Japonica  767 92.70% 2.00% 0.13% 0.00% A: 5.22%
Tropical Japonica  504 68.10% 30.80% 0.20% 0.00% A: 0.99%
Japonica Intermediate  241 70.10% 20.30% 1.24% 0.83% A: 7.47%
VI/Aromatic  96 64.60% 4.20% 0.00% 0.00% A: 31.25%
Intermediate  90 91.10% 2.20% 0.00% 5.56% A: 1.11%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0401947660 G -> DEL N N silent_mutation Average:62.781; most accessible tissue: Zhenshan97 flag leaf, score: 80.156 N N N N
vg0401947660 G -> A LOC_Os04g04190.1 upstream_gene_variant ; 1691.0bp to feature; MODIFIER silent_mutation Average:62.781; most accessible tissue: Zhenshan97 flag leaf, score: 80.156 N N N N
vg0401947660 G -> A LOC_Os04g04180.1 intron_variant ; MODIFIER silent_mutation Average:62.781; most accessible tissue: Zhenshan97 flag leaf, score: 80.156 N N N N
vg0401947660 G -> GA LOC_Os04g04190.1 upstream_gene_variant ; 1690.0bp to feature; MODIFIER silent_mutation Average:62.781; most accessible tissue: Zhenshan97 flag leaf, score: 80.156 N N N N
vg0401947660 G -> GA LOC_Os04g04180.1 intron_variant ; MODIFIER silent_mutation Average:62.781; most accessible tissue: Zhenshan97 flag leaf, score: 80.156 N N N N
vg0401947660 G -> T LOC_Os04g04190.1 upstream_gene_variant ; 1691.0bp to feature; MODIFIER silent_mutation Average:62.781; most accessible tissue: Zhenshan97 flag leaf, score: 80.156 N N N N
vg0401947660 G -> T LOC_Os04g04180.1 intron_variant ; MODIFIER silent_mutation Average:62.781; most accessible tissue: Zhenshan97 flag leaf, score: 80.156 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0401947660 2.11E-06 5.39E-08 mr1155 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401947660 NA 3.88E-06 mr1213 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401947660 NA 6.56E-06 mr1225 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401947660 NA 1.52E-12 mr1410 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401947660 NA 7.42E-08 mr1746 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401947660 NA 7.68E-07 mr1805 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401947660 NA 4.29E-06 mr1228_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401947660 NA 3.33E-16 mr1301_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401947660 NA 7.95E-13 mr1410_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401947660 NA 5.59E-06 mr1606_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401947660 4.46E-07 NA mr1798_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401947660 NA 3.66E-07 mr1905_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251