| Variant ID: vg0401819705 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 1819705 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 127. )
ATGGGGGTAAGATAATACAAAAGAGTTACGTTGATCTCTGTGTTTACAAACAGACGTCATCTATGACGTATGCAGCCAAATCTCGAAATCTTATGCATAA[C/T]
TAAAATAAAAATATGCAAAAAAAATATTAAGATTTAGTATGTAAAAACATACTAGTAGACGATTTTCATGAAAAATAACATCGTGTAGTTATATTCTAAT
ATTAGAATATAACTACACGATGTTATTTTTCATGAAAATCGTCTACTAGTATGTTTTTACATACTAAATCTTAATATTTTTTTTGCATATTTTTATTTTA[G/A]
TTATGCATAAGATTTCGAGATTTGGCTGCATACGTCATAGATGACGTCTGTTTGTAAACACAGAGATCAACGTAACTCTTTTGTATTATCTTACCCCCAT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 83.80% | 15.50% | 0.68% | 0.00% | NA |
| All Indica | 2759 | 73.00% | 25.90% | 1.12% | 0.00% | NA |
| All Japonica | 1512 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 34.60% | 61.70% | 3.70% | 0.00% | NA |
| Indica II | 465 | 79.80% | 19.40% | 0.86% | 0.00% | NA |
| Indica III | 913 | 90.00% | 10.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 78.10% | 21.20% | 0.64% | 0.00% | NA |
| Temperate Japonica | 767 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 85.60% | 13.30% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0401819705 | C -> T | LOC_Os04g03980.1 | upstream_gene_variant ; 3632.0bp to feature; MODIFIER | silent_mutation | Average:54.3; most accessible tissue: Callus, score: 85.855 | N | N | N | N |
| vg0401819705 | C -> T | LOC_Os04g03980-LOC_Os04g03990 | intergenic_region ; MODIFIER | silent_mutation | Average:54.3; most accessible tissue: Callus, score: 85.855 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0401819705 | NA | 3.73E-06 | mr1201 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0401819705 | NA | 7.07E-07 | mr1274 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0401819705 | NA | 2.05E-08 | mr1565 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0401819705 | NA | 5.93E-07 | mr1728 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0401819705 | NA | 9.22E-06 | mr1201_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0401819705 | NA | 2.04E-06 | mr1201_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0401819705 | 2.11E-06 | 7.23E-12 | mr1565_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |