\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0401797174:

Variant ID: vg0401797174 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 1797174
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ACCACTTCATTGCCAATTTCCAAGGCACTTTCGAGCGCCCCGGCACATAATTTGATCTTTATAATGTTATCCAGAAGTCCGGAGAATCTCTTCGAGATTA[C/T]
ATCCGGCAATTTTCTGAACAACGCAACAAGATCTCCGACATCATTGACGATGTTATCATCGCCGCATTCACCAAAGGAATTCGCCACGAAGAATTGGTCG

Reverse complement sequence

CGACCAATTCTTCGTGGCGAATTCCTTTGGTGAATGCGGCGATGATAACATCGTCAATGATGTCGGAGATCTTGTTGCGTTGTTCAGAAAATTGCCGGAT[G/A]
TAATCTCGAAGAGATTCTCCGGACTTCTGGATAACATTATAAAGATCAAATTATGTGCCGGGGCGCTCGAAAGTGCCTTGGAAATTGGCAATGAAGTGGT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 70.80% 9.10% 4.55% 15.53% NA
All Indica  2759 81.40% 0.60% 5.84% 12.18% NA
All Japonica  1512 48.00% 26.50% 1.46% 24.01% NA
Aus  269 95.50% 0.00% 0.37% 4.09% NA
Indica I  595 66.70% 0.00% 7.06% 26.22% NA
Indica II  465 80.20% 0.90% 10.97% 7.96% NA
Indica III  913 91.50% 0.80% 2.41% 5.37% NA
Indica Intermediate  786 81.60% 0.60% 5.85% 11.96% NA
Temperate Japonica  767 76.50% 2.30% 0.91% 20.21% NA
Tropical Japonica  504 11.10% 64.10% 1.19% 23.61% NA
Japonica Intermediate  241 34.40% 24.90% 3.73% 36.93% NA
VI/Aromatic  96 54.20% 4.20% 27.08% 14.58% NA
Intermediate  90 74.40% 8.90% 5.56% 11.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0401797174 C -> DEL N N silent_mutation Average:19.95; most accessible tissue: Minghui63 panicle, score: 42.799 N N N N
vg0401797174 C -> T LOC_Os04g03920.1 upstream_gene_variant ; 4203.0bp to feature; MODIFIER silent_mutation Average:19.95; most accessible tissue: Minghui63 panicle, score: 42.799 N N N N
vg0401797174 C -> T LOC_Os04g03930.1 upstream_gene_variant ; 2191.0bp to feature; MODIFIER silent_mutation Average:19.95; most accessible tissue: Minghui63 panicle, score: 42.799 N N N N
vg0401797174 C -> T LOC_Os04g03950.1 downstream_gene_variant ; 4821.0bp to feature; MODIFIER silent_mutation Average:19.95; most accessible tissue: Minghui63 panicle, score: 42.799 N N N N
vg0401797174 C -> T LOC_Os04g03940.1 intron_variant ; MODIFIER silent_mutation Average:19.95; most accessible tissue: Minghui63 panicle, score: 42.799 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0401797174 NA 2.66E-06 mr1213 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401797174 9.74E-12 2.40E-32 mr1301 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401797174 NA 1.91E-20 mr1301 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401797174 NA 1.47E-06 mr1338 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401797174 3.09E-11 1.30E-24 mr1410 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401797174 NA 2.46E-16 mr1410 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401797174 7.61E-06 NA mr1411 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401797174 NA 4.12E-08 mr1554 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401797174 NA 1.17E-07 mr1668 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401797174 NA 2.94E-13 mr1771 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401797174 8.39E-15 6.28E-36 mr1301_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401797174 1.35E-06 2.68E-24 mr1301_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401797174 NA 7.48E-10 mr1398_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401797174 3.90E-11 1.47E-25 mr1410_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401797174 NA 1.46E-16 mr1410_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401797174 NA 5.77E-07 mr1696_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401797174 NA 1.80E-08 mr1905_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401797174 1.60E-07 3.00E-16 mr1993_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401797174 NA 1.53E-16 mr1993_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251