Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0401797174:

Variant ID: vg0401797174 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 1797174
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ACCACTTCATTGCCAATTTCCAAGGCACTTTCGAGCGCCCCGGCACATAATTTGATCTTTATAATGTTATCCAGAAGTCCGGAGAATCTCTTCGAGATTA[C/T]
ATCCGGCAATTTTCTGAACAACGCAACAAGATCTCCGACATCATTGACGATGTTATCATCGCCGCATTCACCAAAGGAATTCGCCACGAAGAATTGGTCG

Reverse complement sequence

CGACCAATTCTTCGTGGCGAATTCCTTTGGTGAATGCGGCGATGATAACATCGTCAATGATGTCGGAGATCTTGTTGCGTTGTTCAGAAAATTGCCGGAT[G/A]
TAATCTCGAAGAGATTCTCCGGACTTCTGGATAACATTATAAAGATCAAATTATGTGCCGGGGCGCTCGAAAGTGCCTTGGAAATTGGCAATGAAGTGGT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	70.80%	9.10%	4.55%	15.53%	NA
All Indica	2759	81.40%	0.60%	5.84%	12.18%	NA
All Japonica	1512	48.00%	26.50%	1.46%	24.01%	NA
Aus	269	95.50%	0.00%	0.37%	4.09%	NA
Indica I	595	66.70%	0.00%	7.06%	26.22%	NA
Indica II	465	80.20%	0.90%	10.97%	7.96%	NA
Indica III	913	91.50%	0.80%	2.41%	5.37%	NA
Indica Intermediate	786	81.60%	0.60%	5.85%	11.96%	NA
Temperate Japonica	767	76.50%	2.30%	0.91%	20.21%	NA
Tropical Japonica	504	11.10%	64.10%	1.19%	23.61%	NA
Japonica Intermediate	241	34.40%	24.90%	3.73%	36.93%	NA
VI/Aromatic	96	54.20%	4.20%	27.08%	14.58%	NA
Intermediate	90	74.40%	8.90%	5.56%	11.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0401797174	C -> DEL	N	N	silent_mutation	Average:19.95; most accessible tissue: Minghui63 panicle, score: 42.799	N	N	N	N
vg0401797174	C -> T	LOC_Os04g03920.1	upstream_gene_variant ; 4203.0bp to feature; MODIFIER	silent_mutation	Average:19.95; most accessible tissue: Minghui63 panicle, score: 42.799	N	N	N	N
vg0401797174	C -> T	LOC_Os04g03930.1	upstream_gene_variant ; 2191.0bp to feature; MODIFIER	silent_mutation	Average:19.95; most accessible tissue: Minghui63 panicle, score: 42.799	N	N	N	N
vg0401797174	C -> T	LOC_Os04g03950.1	downstream_gene_variant ; 4821.0bp to feature; MODIFIER	silent_mutation	Average:19.95; most accessible tissue: Minghui63 panicle, score: 42.799	N	N	N	N
vg0401797174	C -> T	LOC_Os04g03940.1	intron_variant ; MODIFIER	silent_mutation	Average:19.95; most accessible tissue: Minghui63 panicle, score: 42.799	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0401797174	NA	2.66E-06	mr1213	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401797174	9.74E-12	2.40E-32	mr1301	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401797174	NA	1.91E-20	mr1301	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401797174	NA	1.47E-06	mr1338	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401797174	3.09E-11	1.30E-24	mr1410	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401797174	NA	2.46E-16	mr1410	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401797174	7.61E-06	NA	mr1411	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401797174	NA	4.12E-08	mr1554	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401797174	NA	1.17E-07	mr1668	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401797174	NA	2.94E-13	mr1771	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401797174	8.39E-15	6.28E-36	mr1301_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401797174	1.35E-06	2.68E-24	mr1301_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401797174	NA	7.48E-10	mr1398_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401797174	3.90E-11	1.47E-25	mr1410_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401797174	NA	1.46E-16	mr1410_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401797174	NA	5.77E-07	mr1696_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401797174	NA	1.80E-08	mr1905_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401797174	1.60E-07	3.00E-16	mr1993_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401797174	NA	1.53E-16	mr1993_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251