\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0401787914:

Variant ID: vg0401787914 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 1787914
Reference Allele: AAlternative Allele: G,T
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.95, G: 0.05, others allele: 0.00, population size: 85. )

Flanking Sequence (100 bp) in Reference Genome:


AAATCATAGTTTGACATGCGTGCTCATATTTATAACTATTTATTCTTTCAGTACTAGGTGATGTACCTGTCGATAACGAGACGCCCGTTGTGACTTCATC[A/G,T]
ATCTTAAGATATGTCAGTCCAATCTTCCGCTGGTGCTCATAAGGGTAGGATATGCGTGTGTTTCTCAACATGAGTGTGCATTGTCTGGACTGTATTTCTA

Reverse complement sequence

TAGAAATACAGTCCAGACAATGCACACTCATGTTGAGAAACACACGCATATCCTACCCTTATGAGCACCAGCGGAAGATTGGACTGACATATCTTAAGAT[T/C,A]
GATGAAGTCACAACGGGCGTCTCGTTATCGACAGGTACATCACCTAGTACTGAAAGAATAAATAGTTATAAATATGAGCACGCATGTCAAACTATGATTT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 24.50% 15.50% 0.42% 57.07% T: 2.52%
All Indica  2759 23.50% 2.00% 0.51% 69.74% T: 4.24%
All Japonica  1512 27.10% 43.20% 0.40% 29.37% NA
Aus  269 26.40% 2.20% 0.00% 71.38% NA
Indica I  595 12.40% 2.00% 0.84% 84.37% T: 0.34%
Indica II  465 37.20% 1.70% 0.65% 60.00% T: 0.43%
Indica III  913 26.50% 1.10% 0.00% 63.31% T: 9.09%
Indica Intermediate  786 20.40% 3.20% 0.76% 71.88% T: 3.82%
Temperate Japonica  767 2.50% 74.60% 0.52% 22.43% NA
Tropical Japonica  504 64.90% 4.00% 0.20% 30.95% NA
Japonica Intermediate  241 26.10% 25.30% 0.41% 48.13% NA
VI/Aromatic  96 12.50% 0.00% 0.00% 87.50% NA
Intermediate  90 20.00% 18.90% 0.00% 58.89% T: 2.22%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0401787914 A -> DEL N N silent_mutation Average:32.846; most accessible tissue: Minghui63 panicle, score: 59.629 N N N N
vg0401787914 A -> G LOC_Os04g03910.1 downstream_gene_variant ; 650.0bp to feature; MODIFIER silent_mutation Average:32.846; most accessible tissue: Minghui63 panicle, score: 59.629 N N N N
vg0401787914 A -> G LOC_Os04g03920.1 downstream_gene_variant ; 3474.0bp to feature; MODIFIER silent_mutation Average:32.846; most accessible tissue: Minghui63 panicle, score: 59.629 N N N N
vg0401787914 A -> G LOC_Os04g03890-LOC_Os04g03910 intergenic_region ; MODIFIER silent_mutation Average:32.846; most accessible tissue: Minghui63 panicle, score: 59.629 N N N N
vg0401787914 A -> T LOC_Os04g03910.1 downstream_gene_variant ; 650.0bp to feature; MODIFIER silent_mutation Average:32.846; most accessible tissue: Minghui63 panicle, score: 59.629 N N N N
vg0401787914 A -> T LOC_Os04g03920.1 downstream_gene_variant ; 3474.0bp to feature; MODIFIER silent_mutation Average:32.846; most accessible tissue: Minghui63 panicle, score: 59.629 N N N N
vg0401787914 A -> T LOC_Os04g03890-LOC_Os04g03910 intergenic_region ; MODIFIER silent_mutation Average:32.846; most accessible tissue: Minghui63 panicle, score: 59.629 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0401787914 NA 9.63E-06 mr1087 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401787914 NA 1.42E-06 mr1094 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401787914 NA 8.87E-07 mr1096 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401787914 NA 7.92E-07 mr1121 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401787914 NA 9.87E-06 mr1211 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401787914 NA 1.34E-07 mr1213 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401787914 NA 4.99E-06 mr1225 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401787914 NA 2.77E-12 mr1235 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401787914 NA 3.44E-06 mr1246 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401787914 NA 9.46E-11 mr1251 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401787914 NA 3.52E-16 mr1301 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401787914 NA 1.40E-13 mr1410 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401787914 NA 7.60E-12 mr1435 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401787914 NA 1.95E-08 mr1533 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401787914 NA 1.88E-10 mr1769 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401787914 NA 3.27E-17 mr1771 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401787914 NA 9.06E-12 mr1784 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401787914 NA 9.12E-08 mr1800 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401787914 NA 3.47E-19 mr1301_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401787914 NA 4.73E-14 mr1410_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401787914 NA 5.29E-06 mr1980_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401787914 NA 4.08E-11 mr1993_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401787914 NA 5.71E-14 mr1993_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251