Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0401787914:

Variant ID: vg0401787914 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 1787914
Reference Allele: A	Alternative Allele: G,T
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.95, G: 0.05, others allele: 0.00, population size: 85. )

Flanking Sequence (100 bp) in Reference Genome:

AAATCATAGTTTGACATGCGTGCTCATATTTATAACTATTTATTCTTTCAGTACTAGGTGATGTACCTGTCGATAACGAGACGCCCGTTGTGACTTCATC[A/G,T]
ATCTTAAGATATGTCAGTCCAATCTTCCGCTGGTGCTCATAAGGGTAGGATATGCGTGTGTTTCTCAACATGAGTGTGCATTGTCTGGACTGTATTTCTA

Reverse complement sequence

TAGAAATACAGTCCAGACAATGCACACTCATGTTGAGAAACACACGCATATCCTACCCTTATGAGCACCAGCGGAAGATTGGACTGACATATCTTAAGAT[T/C,A]
GATGAAGTCACAACGGGCGTCTCGTTATCGACAGGTACATCACCTAGTACTGAAAGAATAAATAGTTATAAATATGAGCACGCATGTCAAACTATGATTT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	24.50%	15.50%	0.42%	57.07%	T: 2.52%
All Indica	2759	23.50%	2.00%	0.51%	69.74%	T: 4.24%
All Japonica	1512	27.10%	43.20%	0.40%	29.37%	NA
Aus	269	26.40%	2.20%	0.00%	71.38%	NA
Indica I	595	12.40%	2.00%	0.84%	84.37%	T: 0.34%
Indica II	465	37.20%	1.70%	0.65%	60.00%	T: 0.43%
Indica III	913	26.50%	1.10%	0.00%	63.31%	T: 9.09%
Indica Intermediate	786	20.40%	3.20%	0.76%	71.88%	T: 3.82%
Temperate Japonica	767	2.50%	74.60%	0.52%	22.43%	NA
Tropical Japonica	504	64.90%	4.00%	0.20%	30.95%	NA
Japonica Intermediate	241	26.10%	25.30%	0.41%	48.13%	NA
VI/Aromatic	96	12.50%	0.00%	0.00%	87.50%	NA
Intermediate	90	20.00%	18.90%	0.00%	58.89%	T: 2.22%

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0401787914	A -> DEL	N	N	silent_mutation	Average:32.846; most accessible tissue: Minghui63 panicle, score: 59.629	N	N	N	N
vg0401787914	A -> G	LOC_Os04g03910.1	downstream_gene_variant ; 650.0bp to feature; MODIFIER	silent_mutation	Average:32.846; most accessible tissue: Minghui63 panicle, score: 59.629	N	N	N	N
vg0401787914	A -> G	LOC_Os04g03920.1	downstream_gene_variant ; 3474.0bp to feature; MODIFIER	silent_mutation	Average:32.846; most accessible tissue: Minghui63 panicle, score: 59.629	N	N	N	N
vg0401787914	A -> G	LOC_Os04g03890-LOC_Os04g03910	intergenic_region ; MODIFIER	silent_mutation	Average:32.846; most accessible tissue: Minghui63 panicle, score: 59.629	N	N	N	N
vg0401787914	A -> T	LOC_Os04g03910.1	downstream_gene_variant ; 650.0bp to feature; MODIFIER	silent_mutation	Average:32.846; most accessible tissue: Minghui63 panicle, score: 59.629	N	N	N	N
vg0401787914	A -> T	LOC_Os04g03920.1	downstream_gene_variant ; 3474.0bp to feature; MODIFIER	silent_mutation	Average:32.846; most accessible tissue: Minghui63 panicle, score: 59.629	N	N	N	N
vg0401787914	A -> T	LOC_Os04g03890-LOC_Os04g03910	intergenic_region ; MODIFIER	silent_mutation	Average:32.846; most accessible tissue: Minghui63 panicle, score: 59.629	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0401787914	NA	9.63E-06	mr1087	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401787914	NA	1.42E-06	mr1094	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401787914	NA	8.87E-07	mr1096	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401787914	NA	7.92E-07	mr1121	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401787914	NA	9.87E-06	mr1211	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401787914	NA	1.34E-07	mr1213	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401787914	NA	4.99E-06	mr1225	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401787914	NA	2.77E-12	mr1235	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401787914	NA	3.44E-06	mr1246	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401787914	NA	9.46E-11	mr1251	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401787914	NA	3.52E-16	mr1301	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401787914	NA	1.40E-13	mr1410	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401787914	NA	7.60E-12	mr1435	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401787914	NA	1.95E-08	mr1533	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401787914	NA	1.88E-10	mr1769	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401787914	NA	3.27E-17	mr1771	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401787914	NA	9.06E-12	mr1784	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401787914	NA	9.12E-08	mr1800	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401787914	NA	3.47E-19	mr1301_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401787914	NA	4.73E-14	mr1410_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401787914	NA	5.29E-06	mr1980_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401787914	NA	4.08E-11	mr1993_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401787914	NA	5.71E-14	mr1993_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251