\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0401152271:

Variant ID: vg0401152271 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 1152271
Reference Allele: GAlternative Allele: C
Primary Allele: CSecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.75, C: 0.25, others allele: 0.00, population size: 96. )

Flanking Sequence (100 bp) in Reference Genome:


GATTTGATCTGATGGAGAAGAAGAAGACAATGGAGAATTGGAGATGGAGGAGGATATGCCGGGGGATCACCGAGGTGATAAATACCGTGTGTTGGGTTGG[G/C]
TCTGGCTCGTGTTTGTTGTGGTTGTGACCGTGTGGGGTTAAGACGTAAGACGTGTGTGTGCGCGCTGACCGGGCGACCGTCCACAAGGAAGGAAGGATAC

Reverse complement sequence

GTATCCTTCCTTCCTTGTGGACGGTCGCCCGGTCAGCGCGCACACACACGTCTTACGTCTTAACCCCACACGGTCACAACCACAACAAACACGAGCCAGA[C/G]
CCAACCCAACACACGGTATTTATCACCTCGGTGATCCCCCGGCATATCCTCCTCCATCTCCAATTCTCCATTGTCTTCTTCTTCTCCATCAGATCAAATC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 73.40% 26.50% 0.13% 0.00% NA
All Indica  2759 93.50% 6.40% 0.07% 0.00% NA
All Japonica  1512 36.10% 63.80% 0.13% 0.00% NA
Aus  269 94.10% 5.90% 0.00% 0.00% NA
Indica I  595 97.30% 2.70% 0.00% 0.00% NA
Indica II  465 84.50% 15.50% 0.00% 0.00% NA
Indica III  913 96.30% 3.70% 0.00% 0.00% NA
Indica Intermediate  786 92.70% 7.00% 0.25% 0.00% NA
Temperate Japonica  767 5.00% 94.90% 0.13% 0.00% NA
Tropical Japonica  504 72.80% 27.00% 0.20% 0.00% NA
Japonica Intermediate  241 58.50% 41.50% 0.00% 0.00% NA
VI/Aromatic  96 22.90% 77.10% 0.00% 0.00% NA
Intermediate  90 73.30% 24.40% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0401152271 G -> C LOC_Os04g02910.1 upstream_gene_variant ; 52.0bp to feature; MODIFIER silent_mutation Average:99.609; most accessible tissue: Zhenshan97 root, score: 99.872 N N N N
vg0401152271 G -> C LOC_Os04g02910.3 upstream_gene_variant ; 844.0bp to feature; MODIFIER silent_mutation Average:99.609; most accessible tissue: Zhenshan97 root, score: 99.872 N N N N
vg0401152271 G -> C LOC_Os04g02910.4 upstream_gene_variant ; 52.0bp to feature; MODIFIER silent_mutation Average:99.609; most accessible tissue: Zhenshan97 root, score: 99.872 N N N N
vg0401152271 G -> C LOC_Os04g02910-LOC_Os04g02920 intergenic_region ; MODIFIER silent_mutation Average:99.609; most accessible tissue: Zhenshan97 root, score: 99.872 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0401152271 G C -0.05 -0.07 -0.02 -0.12 -0.06 -0.05

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0401152271 NA 2.40E-07 mr1229 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401152271 NA 4.38E-06 mr1448 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401152271 NA 3.45E-06 mr1977 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401152271 NA 1.73E-06 mr1045_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401152271 1.63E-06 NA mr1079_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401152271 7.53E-07 NA mr1132_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401152271 NA 1.38E-06 mr1211_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401152271 NA 3.71E-07 mr1229_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401152271 NA 8.70E-07 mr1250_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401152271 NA 1.05E-06 mr1250_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401152271 4.87E-07 NA mr1390_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401152271 1.21E-06 NA mr1490_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401152271 NA 1.07E-07 mr1599_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401152271 NA 1.28E-07 mr1880_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401152271 NA 2.13E-08 mr1952_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251