Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0401024189:

Variant ID: vg0401024189 (JBrowse)Variation Type: INDEL
Chromosome: chr04Position: 1024189
Reference Allele: CAAlternative Allele: TA,C
Primary Allele: CASecondary Allele: TA

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TGTGGGTAAGGATGCAAGCCGGCCAACCCGTGAGTTCACTTGTAAGTAAGTCAAATAAATGATAAACCCATTTAGATATACAAGTGGGTCGATCCATAAA[CA/TA,C]
TATTAATATGTCAAATTAATAGATAACTCGCTGGTCAAATCGTACTAATTTTGTCTATAAGCGGGTTTGCGGACAAGCCCACTTGCACCCCTACTTGTGG

Reverse complement sequence

CCACAAGTAGGGGTGCAAGTGGGCTTGTCCGCAAACCCGCTTATAGACAAAATTAGTACGATTTGACCAGCGAGTTATCTATTAATTTGACATATTAATA[TG/TA,G]
TTTATGGATCGACCCACTTGTATATCTAAATGGGTTTATCATTTATTTGACTTACTTACAAGTGAACTCACGGGTTGGCCGGCTTGCATCCTTACCCACA

Allele Frequencies:

Populations Population SizeFrequency of CA(primary allele) Frequency of TA(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 61.50% 38.20% 0.19% 0.08% C: 0.04%
All Indica  2759 43.10% 56.70% 0.18% 0.04% NA
All Japonica  1512 91.10% 8.60% 0.07% 0.13% C: 0.07%
Aus  269 74.30% 25.70% 0.00% 0.00% NA
Indica I  595 17.30% 82.70% 0.00% 0.00% NA
Indica II  465 45.20% 54.60% 0.22% 0.00% NA
Indica III  913 54.70% 45.30% 0.00% 0.00% NA
Indica Intermediate  786 48.10% 51.30% 0.51% 0.13% NA
Temperate Japonica  767 93.90% 6.00% 0.00% 0.13% NA
Tropical Japonica  504 85.30% 14.10% 0.20% 0.20% C: 0.20%
Japonica Intermediate  241 94.60% 5.40% 0.00% 0.00% NA
VI/Aromatic  96 89.60% 9.40% 1.04% 0.00% NA
Intermediate  90 60.00% 35.60% 2.22% 1.11% C: 1.11%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0401024189 CA -> C LOC_Os04g02690.1 3_prime_UTR_variant ; 35.0bp to feature; MODIFIER silent_mutation Average:85.999; most accessible tissue: Zhenshan97 young leaf, score: 94.425 N N N N
vg0401024189 CA -> C LOC_Os04g02680.1 upstream_gene_variant ; 4496.0bp to feature; MODIFIER silent_mutation Average:85.999; most accessible tissue: Zhenshan97 young leaf, score: 94.425 N N N N
vg0401024189 CA -> DEL N N silent_mutation Average:85.999; most accessible tissue: Zhenshan97 young leaf, score: 94.425 N N N N
vg0401024189 CA -> TA LOC_Os04g02690.1 3_prime_UTR_variant ; 36.0bp to feature; MODIFIER silent_mutation Average:85.999; most accessible tissue: Zhenshan97 young leaf, score: 94.425 N N N N
vg0401024189 CA -> TA LOC_Os04g02680.1 upstream_gene_variant ; 4495.0bp to feature; MODIFIER silent_mutation Average:85.999; most accessible tissue: Zhenshan97 young leaf, score: 94.425 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0401024189 CA C 0.0 -0.04 -0.04 0.01 0.0 0.01
vg0401024189 CA TA 0.14 0.08 0.06 0.04 0.06 0.04

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0401024189 NA 1.82E-06 mr1890 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251