Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0401005726:

Variant ID: vg0401005726 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 1005726
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.81, A: 0.18, others allele: 0.00, population size: 99. )

Flanking Sequence (100 bp) in Reference Genome:

CGTGGAGTAACCTGCACTCACCATCGCGGAGAAGTCCGTCCGCACACCGCCCACGCGTGGATCTGGCCATCCCAAGCTCTGGCCAAATCCGGTGGCCACT[G/A]
CGCTGGGCCAGGGAGTGGAAGAGGTAGCCGCCACCACCGTCATGCCGCATAGGGGAGAGGAAGTTGTGTTCACTGCCATTGTGCACAGGGGATAGCCGCC

Reverse complement sequence

GGCGGCTATCCCCTGTGCACAATGGCAGTGAACACAACTTCCTCTCCCCTATGCGGCATGACGGTGGTGGCGGCTACCTCTTCCACTCCCTGGCCCAGCG[C/T]
AGTGGCCACCGGATTTGGCCAGAGCTTGGGATGGCCAGATCCACGCGTGGGCGGTGTGCGGACGGACTTCTCCGCGATGGTGAGTGCAGGTTACTCCACG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	82.30%	17.60%	0.11%	0.00%	NA
All Indica	2759	78.60%	21.20%	0.18%	0.00%	NA
All Japonica	1512	89.70%	10.30%	0.00%	0.00%	NA
Aus	269	99.30%	0.70%	0.00%	0.00%	NA
Indica I	595	96.60%	3.40%	0.00%	0.00%	NA
Indica II	465	70.80%	29.00%	0.22%	0.00%	NA
Indica III	913	67.90%	31.90%	0.22%	0.00%	NA
Indica Intermediate	786	82.10%	17.70%	0.25%	0.00%	NA
Temperate Japonica	767	91.50%	8.50%	0.00%	0.00%	NA
Tropical Japonica	504	91.50%	8.50%	0.00%	0.00%	NA
Japonica Intermediate	241	80.50%	19.50%	0.00%	0.00%	NA
VI/Aromatic	96	21.90%	78.10%	0.00%	0.00%	NA
Intermediate	90	85.60%	14.40%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0401005726	G -> A	LOC_Os04g02660.1	missense_variant ; p.Ala27Val; MODERATE	nonsynonymous_codon ; A27V	Average:75.351; most accessible tissue: Minghui63 young leaf, score: 85.826	unknown	unknown	DELETERIOUS	0.00

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg0401005726	G	A	-0.16	-0.09	-0.08	-0.12	-0.15	-0.16

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0401005726	4.40E-07	4.40E-07	mr1343	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401005726	NA	4.73E-06	mr1354	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401005726	7.29E-07	8.72E-08	mr1829	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401005726	1.46E-06	3.30E-09	mr1829	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401005726	8.09E-07	NA	mr1842	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401005726	7.40E-06	7.40E-06	mr1842	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401005726	NA	2.49E-08	mr1354_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401005726	3.73E-06	1.55E-09	mr1829_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401005726	NA	8.26E-06	mr1842_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401005726	NA	1.10E-07	mr1902_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251