Variant ID: vg0400897236 (JBrowse) | Variation Type: INDEL |
Chromosome: chr04 | Position: 897236 |
Reference Allele: C | Alternative Allele: T,CAAT |
Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.98, T: 0.02, others allele: 0.00, population size: 109. )
TTTTTCGGTGGAACAAAAAATGAAATGAATTCTCTTAATAGGGGGTTTCCAAAATATGTGGGTTTTTTTTGTTGCAATGGAATATTTCAGTGCACTGCAA[C/T,CAAT]
ATTAGATCTATACATAGTGAAATATTGTGAGTACACTAGATCGGGGGGAACGCCCGATTGGCTCCACCCCCGTCGGGCTCCCGAGCCCTGTCATTCTCCT
AGGAGAATGACAGGGCTCGGGAGCCCGACGGGGGTGGAGCCAATCGGGCGTTCCCCCCGATCTAGTGTACTCACAATATTTCACTATGTATAGATCTAAT[G/A,ATTG]
TTGCAGTGCACTGAAATATTCCATTGCAACAAAAAAAACCCACATATTTTGGAAACCCCCTATTAAGAGAATTCATTTCATTTTTTGTTCCACCGAAAAA
Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 76.20% | 18.90% | 0.32% | 2.31% | CAAT: 2.33% |
All Indica | 2759 | 64.00% | 29.60% | 0.54% | 1.85% | CAAT: 3.91% |
All Japonica | 1512 | 93.70% | 2.60% | 0.00% | 3.64% | CAAT: 0.07% |
Aus | 269 | 97.80% | 2.20% | 0.00% | 0.00% | NA |
Indica I | 595 | 77.80% | 16.60% | 0.00% | 0.00% | CAAT: 5.55% |
Indica II | 465 | 44.50% | 44.70% | 1.29% | 7.96% | CAAT: 1.51% |
Indica III | 913 | 71.30% | 25.10% | 0.22% | 0.22% | CAAT: 3.18% |
Indica Intermediate | 786 | 56.70% | 35.90% | 0.89% | 1.53% | CAAT: 4.96% |
Temperate Japonica | 767 | 98.80% | 1.20% | 0.00% | 0.00% | NA |
Tropical Japonica | 504 | 84.30% | 5.00% | 0.00% | 10.71% | NA |
Japonica Intermediate | 241 | 96.70% | 2.50% | 0.00% | 0.41% | CAAT: 0.41% |
VI/Aromatic | 96 | 93.80% | 6.20% | 0.00% | 0.00% | NA |
Intermediate | 90 | 72.20% | 23.30% | 0.00% | 3.33% | CAAT: 1.11% |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg0400897236 | C -> CAAT | LOC_Os04g02460.1 | upstream_gene_variant ; 2638.0bp to feature; MODIFIER | silent_mutation | Average:35.963; most accessible tissue: Minghui63 root, score: 56.226 | N | N | N | N |
vg0400897236 | C -> CAAT | LOC_Os04g02470.1 | downstream_gene_variant ; 1248.0bp to feature; MODIFIER | silent_mutation | Average:35.963; most accessible tissue: Minghui63 root, score: 56.226 | N | N | N | N |
vg0400897236 | C -> CAAT | LOC_Os04g02480.1 | downstream_gene_variant ; 1769.0bp to feature; MODIFIER | silent_mutation | Average:35.963; most accessible tissue: Minghui63 root, score: 56.226 | N | N | N | N |
vg0400897236 | C -> CAAT | LOC_Os04g02490.1 | downstream_gene_variant ; 2568.0bp to feature; MODIFIER | silent_mutation | Average:35.963; most accessible tissue: Minghui63 root, score: 56.226 | N | N | N | N |
vg0400897236 | C -> CAAT | LOC_Os04g02470-LOC_Os04g02480 | intergenic_region ; MODIFIER | silent_mutation | Average:35.963; most accessible tissue: Minghui63 root, score: 56.226 | N | N | N | N |
vg0400897236 | C -> DEL | N | N | silent_mutation | Average:35.963; most accessible tissue: Minghui63 root, score: 56.226 | N | N | N | N |
vg0400897236 | C -> T | LOC_Os04g02460.1 | upstream_gene_variant ; 2637.0bp to feature; MODIFIER | silent_mutation | Average:35.963; most accessible tissue: Minghui63 root, score: 56.226 | N | N | N | N |
vg0400897236 | C -> T | LOC_Os04g02470.1 | downstream_gene_variant ; 1247.0bp to feature; MODIFIER | silent_mutation | Average:35.963; most accessible tissue: Minghui63 root, score: 56.226 | N | N | N | N |
vg0400897236 | C -> T | LOC_Os04g02480.1 | downstream_gene_variant ; 1770.0bp to feature; MODIFIER | silent_mutation | Average:35.963; most accessible tissue: Minghui63 root, score: 56.226 | N | N | N | N |
vg0400897236 | C -> T | LOC_Os04g02490.1 | downstream_gene_variant ; 2569.0bp to feature; MODIFIER | silent_mutation | Average:35.963; most accessible tissue: Minghui63 root, score: 56.226 | N | N | N | N |
vg0400897236 | C -> T | LOC_Os04g02470-LOC_Os04g02480 | intergenic_region ; MODIFIER | silent_mutation | Average:35.963; most accessible tissue: Minghui63 root, score: 56.226 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg0400897236 | 5.35E-06 | NA | mr1744_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0400897236 | 1.06E-08 | 1.06E-08 | mr1744_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |