Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0400559351:

Variant ID: vg0400559351 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 559351
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.01, others allele: 0.00, population size: 86. )

Flanking Sequence (100 bp) in Reference Genome:

AATTGATCGAGCACCCGTCTCGTCTCCTTCATCCATCCGCCGCACCACCAACGCGAAGAGTTTTATCTAGTACTCCCTCCGTATTTTCATGTATGGCGCC[A/G]
TTGACTTTTCAACCAACGTTTGACTATTCGTCTTATTCAATTTTTTTTACAAATATAAAAATATTTATGTCATGCTTAAAGAACATTTGATGATAAATTA

Reverse complement sequence

TAATTTATCATCAAATGTTCTTTAAGCATGACATAAATATTTTTATATTTGTAAAAAAAATTGAATAAGACGAATAGTCAAACGTTGGTTGAAAAGTCAA[T/C]
GGCGCCATACATGAAAATACGGAGGGAGTACTAGATAAAACTCTTCGCGTTGGTGGTGCGGCGGATGGATGAAGGAGACGAGACGGGTGCTCGATCAATT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	75.20%	15.90%	0.28%	8.68%	NA
All Indica	2759	95.10%	0.60%	0.11%	4.24%	NA
All Japonica	1512	50.40%	47.60%	0.46%	1.52%	NA
Aus	269	10.40%	0.40%	0.37%	88.85%	NA
Indica I	595	97.80%	1.20%	0.00%	1.01%	NA
Indica II	465	97.60%	1.10%	0.00%	1.29%	NA
Indica III	913	91.50%	0.00%	0.11%	8.43%	NA
Indica Intermediate	786	95.70%	0.50%	0.25%	3.56%	NA
Temperate Japonica	767	19.70%	79.90%	0.39%	0.00%	NA
Tropical Japonica	504	86.70%	8.70%	0.40%	4.17%	NA
Japonica Intermediate	241	72.20%	26.10%	0.83%	0.83%	NA
VI/Aromatic	96	76.00%	0.00%	1.04%	22.92%	NA
Intermediate	90	73.30%	15.60%	1.11%	10.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0400559351	A -> DEL	N	N	silent_mutation	Average:64.996; most accessible tissue: Zhenshan97 root, score: 88.474	N	N	N	N
vg0400559351	A -> G	LOC_Os04g01890.1	upstream_gene_variant ; 1134.0bp to feature; MODIFIER	silent_mutation	Average:64.996; most accessible tissue: Zhenshan97 root, score: 88.474	N	N	N	N
vg0400559351	A -> G	LOC_Os04g01874-LOC_Os04g01890	intergenic_region ; MODIFIER	silent_mutation	Average:64.996; most accessible tissue: Zhenshan97 root, score: 88.474	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0400559351	NA	3.44E-06	mr1056	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400559351	NA	1.02E-06	mr1045_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400559351	NA	5.26E-08	mr1229_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400559351	NA	6.12E-07	mr1229_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400559351	NA	5.10E-08	mr1252_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400559351	NA	1.06E-06	mr1555_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400559351	NA	1.76E-06	mr1680_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400559351	NA	1.21E-06	mr1693_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400559351	NA	6.15E-07	mr1763_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400559351	NA	2.51E-06	mr1785_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400559351	6.68E-06	NA	mr1829_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400559351	NA	4.82E-06	mr1829_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400559351	NA	1.02E-11	mr1844_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400559351	NA	1.19E-08	mr1880_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400559351	NA	2.31E-07	mr1880_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400559351	1.05E-06	NA	mr1902_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400559351	NA	1.79E-07	mr1902_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400559351	4.30E-06	4.30E-06	mr1971_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251