Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0400392420:

Variant ID: vg0400392420 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 392420
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 94. )

Flanking Sequence (100 bp) in Reference Genome:

GAATGTTATTTCGATGGGTATTTAGGGCCAGGAGTAGGGCTCTAGCCCTAGCTGCCTTACTCCTTGCTCCGCCCCTGCAGCTAACGTTGAGGCCATAGGA[G/A]
TAGCCTCCATGTCATCGACATTGTCCATTGTAACGCCCCGATTTTCGTTCGGGATTAAAAATCAATTAATAATGCATTTCAAGAAATTATATTAAAAGTT

Reverse complement sequence

AACTTTTAATATAATTTCTTGAAATGCATTATTAATTGATTTTTAATCCCGAACGAAAATCGGGGCGTTACAATGGACAATGTCGATGACATGGAGGCTA[C/T]
TCCTATGGCCTCAACGTTAGCTGCAGGGGCGGAGCAAGGAGTAAGGCAGCTAGGGCTAGAGCCCTACTCCTGGCCCTAAATACCCATCGAAATAACATTC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	43.40%	31.70%	3.68%	21.16%	NA
All Indica	2759	9.00%	50.90%	6.02%	34.11%	NA
All Japonica	1512	92.50%	4.20%	0.33%	2.98%	NA
Aus	269	98.90%	0.40%	0.00%	0.74%	NA
Indica I	595	2.50%	48.60%	9.24%	39.66%	NA
Indica II	465	5.60%	43.90%	4.09%	46.45%	NA
Indica III	913	9.30%	60.70%	3.83%	26.18%	NA
Indica Intermediate	786	15.60%	45.30%	7.25%	31.81%	NA
Temperate Japonica	767	97.80%	0.50%	0.26%	1.43%	NA
Tropical Japonica	504	83.10%	10.90%	0.60%	5.36%	NA
Japonica Intermediate	241	95.40%	1.70%	0.00%	2.90%	NA
VI/Aromatic	96	93.80%	5.20%	1.04%	0.00%	NA
Intermediate	90	53.30%	31.10%	2.22%	13.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0400392420	G -> DEL	N	N	silent_mutation	Average:61.965; most accessible tissue: Zhenshan97 flower, score: 78.132	N	N	N	N
vg0400392420	G -> A	LOC_Os04g01590.1	upstream_gene_variant ; 4061.0bp to feature; MODIFIER	silent_mutation	Average:61.965; most accessible tissue: Zhenshan97 flower, score: 78.132	N	N	N	N
vg0400392420	G -> A	LOC_Os04g01580.1	downstream_gene_variant ; 1118.0bp to feature; MODIFIER	silent_mutation	Average:61.965; most accessible tissue: Zhenshan97 flower, score: 78.132	N	N	N	N
vg0400392420	G -> A	LOC_Os04g01580-LOC_Os04g01590	intergenic_region ; MODIFIER	silent_mutation	Average:61.965; most accessible tissue: Zhenshan97 flower, score: 78.132	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0400392420	NA	6.76E-21	mr1003	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400392420	NA	6.93E-13	mr1010	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400392420	NA	2.93E-12	mr1034	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400392420	NA	3.08E-28	mr1037	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400392420	NA	6.50E-08	mr1045	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400392420	NA	7.32E-23	mr1051	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400392420	NA	1.39E-16	mr1147	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400392420	NA	1.00E-14	mr1199	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400392420	NA	3.50E-30	mr1208	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400392420	NA	3.93E-15	mr1270	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400392420	NA	3.50E-11	mr1299	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400392420	NA	4.92E-07	mr1321	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400392420	NA	1.92E-12	mr1329	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400392420	NA	1.51E-08	mr1342	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400392420	NA	6.28E-06	mr1345	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400392420	NA	1.44E-07	mr1610	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400392420	NA	4.58E-14	mr1655	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400392420	NA	1.48E-08	mr1666	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400392420	NA	5.75E-18	mr1700	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400392420	NA	1.90E-10	mr1712	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400392420	NA	2.23E-08	mr1717	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400392420	NA	2.91E-06	mr1727	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400392420	NA	1.70E-08	mr1756	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400392420	NA	1.89E-11	mr1770	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400392420	NA	4.26E-51	mr1798	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400392420	NA	2.07E-10	mr1819	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400392420	NA	9.78E-06	mr1872	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400392420	NA	2.77E-18	mr1913	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400392420	NA	3.04E-09	mr1946	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400392420	NA	4.00E-31	mr1037_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400392420	NA	5.23E-13	mr1147_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400392420	NA	5.37E-37	mr1208_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400392420	NA	7.28E-07	mr1212_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400392420	NA	7.68E-17	mr1457_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400392420	NA	1.72E-50	mr1458_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400392420	NA	3.14E-21	mr1551_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400392420	NA	2.87E-10	mr1649_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400392420	NA	4.66E-12	mr1666_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400392420	NA	1.23E-68	mr1798_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251