\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0400388457:

Variant ID: vg0400388457 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 388457
Reference Allele: CAlternative Allele: A
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ATAATAATTTTTTTCCTCAAAAACGCACATTAACAGAATATCCATTTACCCAAAATGCCTTTTTGCGTAAAAGTTTTTTCTTACAAGTTAAATAAATATA[C/A]
TTTTTAAGTTTATAAAATTTAATGCTTAATCTTATTAAAGAACTTTCTCGTTTTACATGTCGCAAACAATTCTCAACCAAATCAGCTCTTACTATAAACT

Reverse complement sequence

AGTTTATAGTAAGAGCTGATTTGGTTGAGAATTGTTTGCGACATGTAAAACGAGAAAGTTCTTTAATAAGATTAAGCATTAAATTTTATAAACTTAAAAA[G/T]
TATATTTATTTAACTTGTAAGAAAAAACTTTTACGCAAAAAGGCATTTTGGGTAAATGGATATTCTGTTAATGTGCGTTTTTGAGGAAAAAAATTATTAT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 90.50% 9.40% 0.11% 0.00% NA
All Indica  2759 97.90% 2.10% 0.07% 0.00% NA
All Japonica  1512 90.30% 9.50% 0.20% 0.00% NA
Aus  269 19.30% 80.70% 0.00% 0.00% NA
Indica I  595 99.50% 0.50% 0.00% 0.00% NA
Indica II  465 98.90% 1.10% 0.00% 0.00% NA
Indica III  913 96.40% 3.40% 0.22% 0.00% NA
Indica Intermediate  786 97.70% 2.30% 0.00% 0.00% NA
Temperate Japonica  767 81.40% 18.30% 0.39% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 98.30% 1.70% 0.00% 0.00% NA
VI/Aromatic  96 81.20% 18.80% 0.00% 0.00% NA
Intermediate  90 91.10% 8.90% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0400388457 C -> A LOC_Os04g01570.1 upstream_gene_variant ; 1445.0bp to feature; MODIFIER silent_mutation Average:25.428; most accessible tissue: Callus, score: 54.904 N N N N
vg0400388457 C -> A LOC_Os04g01580.1 upstream_gene_variant ; 2393.0bp to feature; MODIFIER silent_mutation Average:25.428; most accessible tissue: Callus, score: 54.904 N N N N
vg0400388457 C -> A LOC_Os04g01560.1 downstream_gene_variant ; 4164.0bp to feature; MODIFIER silent_mutation Average:25.428; most accessible tissue: Callus, score: 54.904 N N N N
vg0400388457 C -> A LOC_Os04g01570-LOC_Os04g01580 intergenic_region ; MODIFIER silent_mutation Average:25.428; most accessible tissue: Callus, score: 54.904 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0400388457 NA 4.70E-07 mr1006 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400388457 NA 4.93E-07 mr1052 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400388457 NA 5.33E-07 mr1126 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400388457 NA 3.51E-08 mr1210 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400388457 NA 6.94E-08 mr1305 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400388457 NA 3.64E-10 mr1585 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400388457 NA 9.63E-09 mr1585 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400388457 NA 1.27E-07 mr1586 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400388457 4.85E-10 NA mr1672 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400388457 2.96E-09 2.72E-10 mr1672 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400388457 NA 2.00E-06 mr1931 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400388457 3.74E-06 1.81E-12 mr1166_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400388457 3.09E-08 3.72E-24 mr1305_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400388457 5.20E-10 1.59E-12 mr1305_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400388457 NA 2.66E-14 mr1409_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400388457 NA 4.10E-06 mr1409_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400388457 2.01E-09 2.32E-11 mr1585_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400388457 4.91E-08 1.28E-12 mr1585_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400388457 3.11E-09 NA mr1670_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400388457 6.78E-08 6.78E-08 mr1670_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400388457 5.37E-08 NA mr1672_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400388457 3.83E-09 3.46E-09 mr1672_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400388457 NA 4.76E-06 mr1703_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400388457 NA 1.84E-06 mr1762_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400388457 7.57E-06 2.83E-09 mr1765_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400388457 1.92E-06 2.68E-08 mr1765_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251