\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0400068159:

Variant ID: vg0400068159 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 68159
Reference Allele: AAlternative Allele: G,T
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.85, A: 0.10, T: 0.04, others allele: 0.00, population size: 107. )

Flanking Sequence (100 bp) in Reference Genome:


TGAGCTACACTTGGTCTATATCACCCGGAAGATTTATTACTTGGGAGCATGTTACATGCGCCATCCTTTAACGGATGTCGAAGGCATATTTTTTGGCCTA[A/G,T]
GCCTAATATGTCTGCAGCCCATATTTTAAGGTGTGGCCTGTCACATTCTTTTAGGGACTTAGGCACTTTTTGCTTAGGCCAAAGTGCGCGTGATTAAGTA

Reverse complement sequence

TACTTAATCACGCGCACTTTGGCCTAAGCAAAAAGTGCCTAAGTCCCTAAAAGAATGTGACAGGCCACACCTTAAAATATGGGCTGCAGACATATTAGGC[T/C,A]
TAGGCCAAAAAATATGCCTTCGACATCCGTTAAAGGATGGCGCATGTAACATGCTCCCAAGTAATAAATCTTCCGGGTGATATAGACCAAGTGTAGCTCA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 81.00% 18.90% 0.06% 0.00% T: 0.04%
All Indica  2759 98.60% 1.40% 0.07% 0.00% NA
All Japonica  1512 44.80% 55.10% 0.07% 0.00% NA
Aus  269 98.90% 0.40% 0.00% 0.00% T: 0.74%
Indica I  595 98.70% 1.30% 0.00% 0.00% NA
Indica II  465 98.10% 1.70% 0.22% 0.00% NA
Indica III  913 99.30% 0.70% 0.00% 0.00% NA
Indica Intermediate  786 97.80% 2.00% 0.13% 0.00% NA
Temperate Japonica  767 12.50% 87.40% 0.13% 0.00% NA
Tropical Japonica  504 84.10% 15.90% 0.00% 0.00% NA
Japonica Intermediate  241 65.60% 34.40% 0.00% 0.00% NA
VI/Aromatic  96 97.90% 2.10% 0.00% 0.00% NA
Intermediate  90 80.00% 20.00% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0400068159 A -> G LOC_Os04g01080.1 downstream_gene_variant ; 3491.0bp to feature; MODIFIER silent_mutation Average:29.837; most accessible tissue: Minghui63 flag leaf, score: 50.629 N N N N
vg0400068159 A -> G LOC_Os04g01100.1 downstream_gene_variant ; 1576.0bp to feature; MODIFIER silent_mutation Average:29.837; most accessible tissue: Minghui63 flag leaf, score: 50.629 N N N N
vg0400068159 A -> G LOC_Os04g01110.1 downstream_gene_variant ; 3096.0bp to feature; MODIFIER silent_mutation Average:29.837; most accessible tissue: Minghui63 flag leaf, score: 50.629 N N N N
vg0400068159 A -> G LOC_Os04g01080-LOC_Os04g01100 intergenic_region ; MODIFIER silent_mutation Average:29.837; most accessible tissue: Minghui63 flag leaf, score: 50.629 N N N N
vg0400068159 A -> T LOC_Os04g01080.1 downstream_gene_variant ; 3491.0bp to feature; MODIFIER silent_mutation Average:29.837; most accessible tissue: Minghui63 flag leaf, score: 50.629 N N N N
vg0400068159 A -> T LOC_Os04g01100.1 downstream_gene_variant ; 1576.0bp to feature; MODIFIER silent_mutation Average:29.837; most accessible tissue: Minghui63 flag leaf, score: 50.629 N N N N
vg0400068159 A -> T LOC_Os04g01110.1 downstream_gene_variant ; 3096.0bp to feature; MODIFIER silent_mutation Average:29.837; most accessible tissue: Minghui63 flag leaf, score: 50.629 N N N N
vg0400068159 A -> T LOC_Os04g01080-LOC_Os04g01100 intergenic_region ; MODIFIER silent_mutation Average:29.837; most accessible tissue: Minghui63 flag leaf, score: 50.629 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0400068159 NA 2.40E-08 mr1252 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400068159 NA 1.08E-07 mr1252 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400068159 NA 7.07E-06 mr1531 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400068159 NA 9.37E-06 mr1550 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400068159 5.75E-06 3.98E-19 mr1768 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400068159 NA 4.11E-07 mr1977 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400068159 NA 3.08E-20 mr1010_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400068159 NA 8.77E-12 mr1011_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400068159 NA 5.10E-07 mr1011_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400068159 NA 8.99E-17 mr1013_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400068159 NA 7.08E-08 mr1013_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400068159 NA 1.68E-06 mr1045_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400068159 NA 3.19E-06 mr1096_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400068159 NA 4.77E-08 mr1121_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400068159 NA 4.01E-06 mr1206_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400068159 NA 1.57E-06 mr1211_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400068159 NA 6.81E-07 mr1229_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400068159 NA 1.95E-07 mr1229_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400068159 NA 2.47E-12 mr1248_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400068159 2.10E-06 3.12E-10 mr1252_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400068159 NA 7.97E-08 mr1252_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400068159 NA 7.29E-07 mr1263_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400068159 NA 5.51E-09 mr1263_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400068159 NA 1.68E-07 mr1550_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400068159 NA 2.52E-07 mr1555_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400068159 NA 4.71E-10 mr1563_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400068159 NA 4.50E-06 mr1596_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400068159 3.16E-06 NA mr1631_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400068159 NA 5.22E-07 mr1693_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400068159 NA 6.69E-06 mr1739_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400068159 NA 2.19E-09 mr1741_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400068159 NA 6.19E-17 mr1746_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400068159 NA 2.76E-06 mr1763_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400068159 NA 5.43E-28 mr1768_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400068159 3.22E-06 NA mr1780_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400068159 NA 1.57E-09 mr1780_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400068159 NA 3.39E-06 mr1785_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400068159 NA 3.07E-07 mr1837_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400068159 NA 6.56E-11 mr1844_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251