Variant ID: vg0336102786 (JBrowse) | Variation Type: SNP |
Chromosome: chr03 | Position: 36102786 |
Reference Allele: G | Alternative Allele: T |
Primary Allele: G | Secondary Allele: T |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 277. )
GGCATATTACCAAAATCCCACGGTCGAATATCCGATTTCTTATGTGGGTCATTCAAGAAAGGGCTATTTGGAAGAAAAGATGTACCATCACCCGATACAT[G/T]
TATCATCATGTTCCATTCAAATGGCTTATCTATTATTTTTAACTTGAAGACTCTATCGTGAGTTTGGGAGCCTATCTGTCGGCTTCTTTTTGTTCTATAT
ATATAGAACAAAAAGAAGCCGACAGATAGGCTCCCAAACTCACGATAGAGTCTTCAAGTTAAAAATAATAGATAAGCCATTTGAATGGAACATGATGATA[C/A]
ATGTATCGGGTGATGGTACATCTTTTCTTCCAAATAGCCCTTTCTTGAATGACCCACATAAGAAATCGGATATTCGACCGTGGGATTTTGGTAATATGCC
Populations | Population Size | Frequency of G(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 89.00% | 11.00% | 0.02% | 0.00% | NA |
All Indica | 2759 | 81.60% | 18.30% | 0.04% | 0.00% | NA |
All Japonica | 1512 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Indica I | 595 | 96.30% | 3.70% | 0.00% | 0.00% | NA |
Indica II | 465 | 88.20% | 11.80% | 0.00% | 0.00% | NA |
Indica III | 913 | 69.40% | 30.60% | 0.00% | 0.00% | NA |
Indica Intermediate | 786 | 80.80% | 19.10% | 0.13% | 0.00% | NA |
Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Tropical Japonica | 504 | 99.40% | 0.60% | 0.00% | 0.00% | NA |
Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Intermediate | 90 | 87.80% | 12.20% | 0.00% | 0.00% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg0336102786 | G -> T | LOC_Os03g63880.1 | upstream_gene_variant ; 4536.0bp to feature; MODIFIER | silent_mutation | Average:59.069; most accessible tissue: Callus, score: 85.635 | N | N | N | N |
vg0336102786 | G -> T | LOC_Os03g63900.1 | upstream_gene_variant ; 727.0bp to feature; MODIFIER | silent_mutation | Average:59.069; most accessible tissue: Callus, score: 85.635 | N | N | N | N |
vg0336102786 | G -> T | LOC_Os03g63910.1 | upstream_gene_variant ; 4465.0bp to feature; MODIFIER | silent_mutation | Average:59.069; most accessible tissue: Callus, score: 85.635 | N | N | N | N |
vg0336102786 | G -> T | LOC_Os03g63890.1 | downstream_gene_variant ; 1905.0bp to feature; MODIFIER | silent_mutation | Average:59.069; most accessible tissue: Callus, score: 85.635 | N | N | N | N |
vg0336102786 | G -> T | LOC_Os03g63890-LOC_Os03g63900 | intergenic_region ; MODIFIER | silent_mutation | Average:59.069; most accessible tissue: Callus, score: 85.635 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg0336102786 | NA | 4.38E-06 | mr1291 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0336102786 | 1.23E-08 | 2.16E-09 | mr1892 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0336102786 | 4.77E-09 | 6.81E-09 | mr1892 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0336102786 | NA | 6.02E-06 | mr1705_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |