\
| Variant ID: vg0335946674 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 35946674 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
GAGAAGAGCAGCGGGCTACAGATTTATAGCCAGCTGTAGCATGGACTCAAAGACACAGTGTTTGTATGACAGGTGGGACCAGGTATTAATAGTGTAGTAT[G/A]
TAACTATTGTATGAATGAGCTATTAGATTGGCTATGGATGAATTGAATCTATAAAATCGAACTTTCAGTGCATTAACTTACAAGAAGATCGAGGAAATTA
TAATTTCCTCGATCTTCTTGTAAGTTAATGCACTGAAAGTTCGATTTTATAGATTCAATTCATCCATAGCCAATCTAATAGCTCATTCATACAATAGTTA[C/T]
ATACTACACTATTAATACCTGGTCCCACCTGTCATACAAACACTGTGTCTTTGAGTCCATGCTACAGCTGGCTATAAATCTGTAGCCCGCTGCTCTTCTC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 94.50% | 5.50% | 0.00% | 0.00% | NA |
| All Indica | 2759 | 92.70% | 7.30% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Aus | 269 | 80.70% | 19.30% | 0.00% | 0.00% | NA |
| Indica I | 595 | 96.30% | 3.70% | 0.00% | 0.00% | NA |
| Indica II | 465 | 93.30% | 6.70% | 0.00% | 0.00% | NA |
| Indica III | 913 | 93.60% | 6.40% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 88.40% | 11.60% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.40% | 0.60% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 94.40% | 5.60% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0335946674 | G -> A | LOC_Os03g63644.1 | downstream_gene_variant ; 1589.0bp to feature; MODIFIER | silent_mutation | Average:54.516; most accessible tissue: Minghui63 panicle, score: 87.605 | N | N | N | N |
| vg0335946674 | G -> A | LOC_Os03g63640-LOC_Os03g63644 | intergenic_region ; MODIFIER | silent_mutation | Average:54.516; most accessible tissue: Minghui63 panicle, score: 87.605 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0335946674 | 4.91E-06 | NA | mr1148_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0335946674 | 3.28E-07 | NA | mr1151_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0335946674 | 2.94E-07 | NA | mr1248_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0335946674 | 7.09E-06 | 8.58E-09 | mr1252_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0335946674 | NA | 1.49E-07 | mr1263_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0335946674 | 2.70E-06 | NA | mr1377_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0335946674 | NA | 5.70E-07 | mr1702_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0335946674 | 2.03E-06 | 9.61E-11 | mr1844_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |