\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0335799204:

Variant ID: vg0335799204 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 35799204
Reference Allele: CAlternative Allele: A
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, A: 0.01, others allele: 0.00, population size: 209. )

Flanking Sequence (100 bp) in Reference Genome:


TCGAGAGGTGTTTGAGAAGAAATTTCTGATGAGGGAAAGTTGCCACTGCCAAGCGCTGATGAGGCTCTTCAGCTGCCTGAGGAGGTTATTCAGCTGCCTC[C/A]
CGAGGTGCTTGAGCGAATTTCTAATGTTCTTAAGGAAACCATCCAGACTACTCCGATGTCAGAGAACATTGAGCTTATTACTCCTTCAGAGATCACCACT

Reverse complement sequence

AGTGGTGATCTCTGAAGGAGTAATAAGCTCAATGTTCTCTGACATCGGAGTAGTCTGGATGGTTTCCTTAAGAACATTAGAAATTCGCTCAAGCACCTCG[G/T]
GAGGCAGCTGAATAACCTCCTCAGGCAGCTGAAGAGCCTCATCAGCGCTTGGCAGTGGCAACTTTCCCTCATCAGAAATTTCTTCTCAAACACCTCTCGA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 68.00% 6.00% 2.39% 23.64% NA
All Indica  2759 54.20% 1.80% 4.06% 39.94% NA
All Japonica  1512 98.60% 1.30% 0.00% 0.13% NA
Aus  269 22.70% 77.30% 0.00% 0.00% NA
Indica I  595 32.60% 0.80% 4.71% 61.85% NA
Indica II  465 71.00% 0.00% 2.15% 26.88% NA
Indica III  913 60.00% 0.90% 4.05% 35.05% NA
Indica Intermediate  786 53.90% 4.60% 4.71% 36.77% NA
Temperate Japonica  767 99.90% 0.10% 0.00% 0.00% NA
Tropical Japonica  504 96.20% 3.60% 0.00% 0.20% NA
Japonica Intermediate  241 99.60% 0.00% 0.00% 0.41% NA
VI/Aromatic  96 97.90% 2.10% 0.00% 0.00% NA
Intermediate  90 80.00% 4.40% 1.11% 14.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0335799204 C -> A LOC_Os03g63350.1 upstream_gene_variant ; 56.0bp to feature; MODIFIER silent_mutation Average:37.159; most accessible tissue: Callus, score: 81.759 N N N N
vg0335799204 C -> A LOC_Os03g63330.1 downstream_gene_variant ; 3708.0bp to feature; MODIFIER silent_mutation Average:37.159; most accessible tissue: Callus, score: 81.759 N N N N
vg0335799204 C -> A LOC_Os03g63330-LOC_Os03g63350 intergenic_region ; MODIFIER silent_mutation Average:37.159; most accessible tissue: Callus, score: 81.759 N N N N
vg0335799204 C -> DEL N N silent_mutation Average:37.159; most accessible tissue: Callus, score: 81.759 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0335799204 9.97E-07 NA mr1249 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335799204 NA 2.66E-07 mr1343 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335799204 NA 5.33E-08 mr1446 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335799204 NA 8.32E-07 mr1665 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335799204 NA 5.07E-07 mr1706 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335799204 NA 1.36E-06 mr1756 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335799204 7.93E-08 NA mr1151_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335799204 2.83E-09 NA mr1248_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335799204 1.31E-07 NA mr1263_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335799204 NA 1.87E-20 mr1305_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335799204 3.96E-06 NA mr1844_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335799204 NA 1.99E-13 mr1846_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335799204 9.65E-06 1.97E-06 mr1951_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251