Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0335799204:

Variant ID: vg0335799204 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 35799204
Reference Allele: C	Alternative Allele: A
Primary Allele: C	Secondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, A: 0.01, others allele: 0.00, population size: 209. )

Flanking Sequence (100 bp) in Reference Genome:

TCGAGAGGTGTTTGAGAAGAAATTTCTGATGAGGGAAAGTTGCCACTGCCAAGCGCTGATGAGGCTCTTCAGCTGCCTGAGGAGGTTATTCAGCTGCCTC[C/A]
CGAGGTGCTTGAGCGAATTTCTAATGTTCTTAAGGAAACCATCCAGACTACTCCGATGTCAGAGAACATTGAGCTTATTACTCCTTCAGAGATCACCACT

Reverse complement sequence

AGTGGTGATCTCTGAAGGAGTAATAAGCTCAATGTTCTCTGACATCGGAGTAGTCTGGATGGTTTCCTTAAGAACATTAGAAATTCGCTCAAGCACCTCG[G/T]
GAGGCAGCTGAATAACCTCCTCAGGCAGCTGAAGAGCCTCATCAGCGCTTGGCAGTGGCAACTTTCCCTCATCAGAAATTTCTTCTCAAACACCTCTCGA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	68.00%	6.00%	2.39%	23.64%	NA
All Indica	2759	54.20%	1.80%	4.06%	39.94%	NA
All Japonica	1512	98.60%	1.30%	0.00%	0.13%	NA
Aus	269	22.70%	77.30%	0.00%	0.00%	NA
Indica I	595	32.60%	0.80%	4.71%	61.85%	NA
Indica II	465	71.00%	0.00%	2.15%	26.88%	NA
Indica III	913	60.00%	0.90%	4.05%	35.05%	NA
Indica Intermediate	786	53.90%	4.60%	4.71%	36.77%	NA
Temperate Japonica	767	99.90%	0.10%	0.00%	0.00%	NA
Tropical Japonica	504	96.20%	3.60%	0.00%	0.20%	NA
Japonica Intermediate	241	99.60%	0.00%	0.00%	0.41%	NA
VI/Aromatic	96	97.90%	2.10%	0.00%	0.00%	NA
Intermediate	90	80.00%	4.40%	1.11%	14.44%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0335799204	C -> A	LOC_Os03g63350.1	upstream_gene_variant ; 56.0bp to feature; MODIFIER	silent_mutation	Average:37.159; most accessible tissue: Callus, score: 81.759	N	N	N	N
vg0335799204	C -> A	LOC_Os03g63330.1	downstream_gene_variant ; 3708.0bp to feature; MODIFIER	silent_mutation	Average:37.159; most accessible tissue: Callus, score: 81.759	N	N	N	N
vg0335799204	C -> A	LOC_Os03g63330-LOC_Os03g63350	intergenic_region ; MODIFIER	silent_mutation	Average:37.159; most accessible tissue: Callus, score: 81.759	N	N	N	N
vg0335799204	C -> DEL	N	N	silent_mutation	Average:37.159; most accessible tissue: Callus, score: 81.759	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0335799204	9.97E-07	NA	mr1249	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335799204	NA	2.66E-07	mr1343	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335799204	NA	5.33E-08	mr1446	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335799204	NA	8.32E-07	mr1665	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335799204	NA	5.07E-07	mr1706	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335799204	NA	1.36E-06	mr1756	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335799204	7.93E-08	NA	mr1151_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335799204	2.83E-09	NA	mr1248_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335799204	1.31E-07	NA	mr1263_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335799204	NA	1.87E-20	mr1305_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335799204	3.96E-06	NA	mr1844_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335799204	NA	1.99E-13	mr1846_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335799204	9.65E-06	1.97E-06	mr1951_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251